Description :
Non Conding Region
Location :
Scaffold_1:84266- 85195
Sequence
929 bases(100 bases per row)
GAAGAACTTGTGCCGTTTCATCGGAAAGATCGCGTTTCTCGTTACAAGAACATTCATTCGGATCGGGTCTGGATTCGGACAAGTGTACAAGAGCTCGATG
CATCTTCCATCAATCTGGTCCAGGCTTAGCTAGCTAGCTATCCTGCTCTCGTGTGATAGAGCTGGCAGATAGCGACTTGGCTTTTGTATTGGAGTCGGTT
CCGTGCTTGCAGGCAAACGGCAACGCGAGCACAGCGACGACAGCTTTTAGTCCACGGAATGTCCACGGATTGTTTTTGCCAAGGTATACGTTTAGGTATC
TTATCCGGGTCTGCGTGGCTTTGAATCCGCTCGGCTGACAAATCAGATCAGAGGCGCGCGTGATCTCGGAGCACTGACACAATGCAAACAAAAATTCATC
TATTTGTTTGTCGAAGGATCCAAATGTGCAAAATTGCTGGTGGCAATTCTGTGTTTGGTGATCCGGAATGTTCGCATCCAAAATGCGCCAATCAGACAAC
TTCATATTGCCACGTGATCACCGCCTCGATCACCATGTCCAGGACCGATGGACACCTTGTCATCACGTGCCGTCGTCACTCGGTGCTGTTGAATGAACAC
GCTGGTGATGCCAAGTCTGCACGAACTAGAGACAATTATGTGGTAGTTCATGCGCTAAACACTCGATGTGTGCACTGAACGACGAGGTATATTGTCAGAT
ACCTCGACACCGTGTTGTCGTGTTGTCGTACGTAGAGGCGAGTCGGAGGACTCGCGCGACACCAAGGCGCGACATGGCAATAGCGACAGGGTGACTAGAG
TCGTGCAGATGGTGCCCCAAATATATTGAAAGATGCATACAGTACCACCAAAATGACCATTTGTTTTAAAAACCCTCGGTGGAATTCCAAGCCAACGCGA
CAACTTGGCACTCACTTTATCTTTTCCCA