Description :
Non Conding Region
Location :
contig_1:84266- 84400
Sequence
134 bases(100 bases per row)
CAGACTGTCAATTAGGATCAACACACAGAGGAACCCGATTTTGAGGCAGAAACTAGCAACAGCAATAAAAAGTCACGTCGTCTTCAAGTGTAAAGGGCTC
TGCATTGCTCTGTGTAAACAGAGACTGGCGGCTC