Description :
Non Conding Region
Location :
Scaffold_1:84256- 84363
Sequence
107 bases(100 bases per row)
GCTGCTCTTGATGACATGGTGCCCAAGCAAGAAACAGACCAACACTCGCGGCGTTATGAACATGTATATTGAAAAAGGATAAGAACCTGGATGGTATGGC
TCCAGGT