Description :
Non Conding Region
Location :
Scaffold_1:84213- 84411
Sequence
198 bases(100 bases per row)
GGAACTCCAAACCGTTCTTGATATCGCCAACTTGGATCGATCTAGGACACTGGGGCCGCCGCGACGGCTTGGAAGGGCAAGAGCAGAAAATGTTGGTTTC
AATTTTGTGTTTCATTCCCGTTTTTAGGatgctgcactcgctgctaCGAGAGCTTATAAGCGTACACGAGTTTGGTGGTGATAGTTGCCTTGAGCTTC