Description :
Non Conding Region
Location :
Scaffold_1:84201- 85110
Sequence
909 bases(100 bases per row)
GCTCTTGCGCAAGGAGGTATCGTGCATTTGGCCGAAGACCCATCGTCACGAGTACTTCCCAGATCAACCACCAATTCCCGTCTGGTTGTGCTGAGTGCTC
ACCACCAAAGCCTTCACAAAGAGGTCAAGACACTGGATATTCTCCCCGCGTCGCGTGTGTTTGCCTACACCATCCACTTCACACCAACTCAATTGCTCCG
CCCACAGGAAGATCAAGACGACACCTCAATATCGCGAGCCAGCGCGCTTTTTTACTTTGAGCACCAAGCCGAGCAGACAGAGGTGTCCGAGCTACTACAT
GCTATACAAGCGACCGTGCCTACTCGTATCATAACCGTGCGTACAGGTTGTGTTGGTGGTCGCCCAGCCCACGATGGATTGTGCTTAGATCGAGCTGTCG
AGACGCTTCGAGGTGCAAAGTTTGTTGTCGTATCGCATCCGACCTATGCCCTCCACGAGTACGACCATGTCAGTGATCAGTTTGTCATGGCGTTTCTCGC
TGGCGCGATCCCGGTGTACGTTGATGCGGCCGCCTCTCAGACGGTAGTATCCCACCAACTCTTCAACCCCTGCGCCTTCATCGACTGCAGATCCTTCACT
AGCGTCCGCGAATGCGCTACTCACATGTCACAGGTCCATGCATCGCCGATTTTGTACTCTCAACTGCGTCGCGAGGCGCCCATCATGGATTTGCGTCAGT
TTGAGGAAGTTTTTTCGTGGCATCCCGAGGTCTCAGGGGCGATGGCGAGTCCTGAAAACTCGACAGGTGCAGTGAGAATGAGCGAGCGATTGCGAAGCCT
GCTAGACAGTAGCCTACAGGACGTCCGGTAGGATAGATGGTCATGTCACATTCCAAATAATCACGTTGATTGAGTATATGGAATGCTAAATGTCTTCTCG
TATCTCTTC