Description :
Non Conding Region
Location :
Scaffold_1:84133- 85074
Sequence
941 bases(100 bases per row)
TTACGCAGGTATCAAAACGAATGAATGGGTATTGGCGCAATCAAAGGGCGAATCGGAAATGGCCCGCTGTTCGTTCAGTTGAGCGAGAGATCTGCTACCT
GAAGGAAAGAGAGAAAGCGCATGATACATCAGTCAGCAGAGGACCATATACATGGAGATAGAGCAGTGGACGTGCGCGCGTGTGTACCTCTCTATTGCTG
GCGTAGCGAAGGTCGTCGTGAGCAGTGCACGGTCTCCTTCCAGCGTTGCTCGCGGGCGTCTGAAGTGCTGGGCAACGTGATGGATTGTATGGGCAGCGCC
ACGAATGGATCAAAGGGCAAAAAGAGCGATACCGAGCACCTGTAGTAGTTGATATTCCCACTTTTAAGGAGCATCAAATTGCTTCCATATTTTATTTAGG
ACGTAGAGTTTGAATGGCATTTTCAAAAACAGAGCGGATTCAATTTGAAAATGTCGTTTTTAAGTTATGCTGAAAACCTCTATGATATAATACTACAATT
CGCTGGTGCGGCGGGTGTTTCCACCAATCGCATTTCAAATCGCTAAGCTTCGAAATAGCCCCCCGGTGGGGGCAGTATTAATTAGTTGCGCGCGATTTTG
TTGTGTGTGTTGCTTCCTCCTAGTGAGCAAGTCCTGAACGTTCGTTGCCTCCCGTACTTCCTACCTGTTGTTGTTGCTGCTGCTGCTGCCACTGATGATC
ACTCCACGCTCGCCCACCGCTTCCATCGTCGCTCGCACGTCTTTCTCCCATGCTGACGACCTCAGCAAACCTCTGTTCTCTCGTCACCTTCCATCGCCAT
CTTTCTCCATCTCTTTCTCTTTCTCTCTCCATCTCTCTTTCTCTCCATCTCTCTTTCTCTCTCTCTCTTTTCTTATTCTCAGGGACGATTGTTTGGACAC
GTGAAGCTCGCTCCGGCCATCAACGCGTGGGAAGACAAGAC