Description :
Non Conding Region
Location :
scaffold_1:84068- 85500
Sequence
1432 bases(100 bases per row)
CAGAAGTGAGGGGGTCAAAAGTCGCTCTTCTCCGGAGTCTTCTCGAGTTTGTGTGGGTCGCCTGTGTGTCGACCAGAAGCAGGACAAACGGATGCGCCTA
TTCTTGCCGCGGAGGATCTCAAGGTGTTCGCTCCTGCGCTCCTGCGGCCGCTGGGCGGGGGTTTCGTTTCTCACACTGACAGACGGGCGCGACCGCTTAG
GAATGGACGGCCACAAAAAGCAATTGGAGTGGAGCGTAGGCGCTGCAAATCCCGCTGTAGCTTCACTAGCTGTGGCACGCACGTACACGCGCCTACAATG
GGAGGGGGGAGGCTTGGGTCGAGCCTTGACTGCCCGATTGCTCGGCGATTGATATGAGGCCCCAGGCATCGCGATCTTCAATTGCATTTTTCCATTCGCT
TTTGTTCCATGGATTGCCTTGGCCAATCAGCTATTTTTAGATACTTTTTCGCCAATCAGAATCGCATTTGAAAATAATCGAAGCACCAAAACAAAGCAAA
AAACAGGCGGTGTCAAAAATACTGAAATATGTTTAGCGAAGTACAGATACACGCACGTTCATGTACTTTTGCCCGCCGCACGAAACTCAAAACAACTTGT
AGGCGTAGCTTCTTAAAGAAGTTCTTTAGTTGTTCTTAGTGCAGTACAACTGAGTCGCGAGAGTATGAGGTACTGTACTGTTGGAAAATGTGGGGTGTGG
GGAGATTGCGAATGTGACTGTCTCTGAGTCGTGATCCAGTAGAAGACCGCTGGAACAGTAGAACGCAATGTCAACGACTGCGATTTGCAAGCGGCAGACT
CGAAAAAAATCTGCAGGCTGCAGTAGATCTGAAAGGTGTTACAGGTCGGCAATATTCAATTCCAAACGCAATGGGGATTCAATTAGTGCAATCCCGCACA
ACCAATCTCGGCATTATTAGAGTGAGGTACATGTACTGGATATTTTGTAAAGGCTCATCGACCATCAGTTGTTGGAAATAGCTTGAGCCTGCAGGAAGCC
GCTCGACAGACTCAAATCGAAATGACGCTCTCCTCAAACGATCCACATACATGTACCAGCGGGAGGCTTGCGCCGTGCGGACCGCAGCTGTCGGAGACAA
CTTTTGATTCTACTGTACAGTACTCGACATTGAATGTGAACGCAGCGGGCTTGATGGTCGTAAGCAGCTCTACCCCACAAAACCACTGGCAGTGGTTGCC
AACCACTTCAACGTCCACATAAAAAATGCAATTATCTGCAAACAATTACAATACAACGCAAAATTCACAACATCAAAATGTCACATTACCTCATTCGGAT
TTTTGCCTGCATACATCGTCCTGGGAATGGCGCGAACGGCTCCGTCGCGTACGCGCGCCGCAAAGGCACCCGCAGCCTCTAAGCGCCGCCATGCTTCGCT
CGACCCTTCTTCGTCTGAGGACGAGCAGGAGA