Description :
Non Conding Region
Location :
Scaffold_1:83706- 84147
Sequence
441 bases(100 bases per row)
ttcgccttttgagctctgtcgtgaagaaattcgagaagataactatcgaattcaagaggttttagctaagtgcgtttcttccattgcgaacttaaaatat
ttatgcaataatgggcagacactgacgctctccgacggcgacacctctggcatcccgtcggagtaaatattctcccagactaggtcctacaagctgcgct
acggtcgtgacgccaggcctagtcagtactagtaagtcatagggccactatgatctgcctttggtgttaacgactcgatcctaacaatccaaatcgcttt
gtacaaaatgtcatgccctttcgagtcggatctttcgctacaaaagattcgcctgttgacgtccgctcatttgactaccatcgtttgattagcatcggca
atcgaagcgccaccaagaagtagcgagatcaaggcggcgaa