Description :
Non Conding Region
Location :
Scaffold_1:83459- 83638
Sequence
179 bases(100 bases per row)
TGGTGATCATCACATTCATAATAGGACTCAAAACAACTAAACAACAACACGGAGTGAGTGAAAGCATCTATCAAGCATAAAGATTGCAAAAGAGTCTTGC
GTGCAAGCACCCTACCCTACAGCAGAATTATTCCAAGCAGGCAGTCAATTGATGTGCATATTGGGTAACCCATCAACCT