Description :
Non Conding Region
Location :
Scaffold_1:83412- 83623
Sequence
211 bases(100 bases per row)
TTCGGATTATTGTgAAGGGGGgAATTTCGCTTGTGGTGACTCTCCCAATAACTTCGTTTtATTGTTTTTGGCCAATCAATTGGGTTTACTAATCAATTTT
AGCGAATGAAAAGTGTTGGCACCATCTATCGAAGTTGATGCTGATGCAATGGTGATGGGATGGATGCATGGTGGACACATCGACGAGCTACTGTACAGCG
GCATGGTGCCT