Description :
Non Conding Region
Location :
Scaffold_1:83112- 83326
Sequence
214 bases(100 bases per row)
AGCGGTGTTCGTTCGTTGTGTGAATGTGGGCGACGGTGATCCCGAGGACTTTACTGGCAGCATCACGATGGGTAGTAATTGCGTGGCGGTGTGGTCGCAG
CAACGTATCCGCCTAGTGTGCAGTGAAGTTGAGCGAGGAGGAGCAAGGTAGCCGGGAATACACCATGACGCCCGTGCGCGTCCAGCGCATTATTATTGCT
TGTGTTGGTCGCGC