Description :
Non Conding Region
Location :
Scaffold_1:8294- 8329
Sequence
35 bases(100 bases per row)
ACCGTCGTTGTAATCGTAACACCCCCTCGCTTAGT