Description :
Non Conding Region
Location :
Scaffold_1:82801- 83841
Sequence
1040 bases(100 bases per row)
CTCCTGCAACTCAACGCCACGAAGGGCCAAATGAGATGAAGGAAGGACGATCAAGCTGCTTGATAATAAAAGGACGGGAGCGGTCGTTTGGTGGTGCCAA
AGAGCACGATGTGCTTCAGGTGGCGCAGAAGGACACGAATAGAGGATGTGATTAGCAGATGTGTGTCTCCCGCTCCACGCCATGGACCGAGGATTGATGA
CGTGGCAGAGCCACTGGCCAAGGTACGCGTCGGAAGGACGGAAGACGCCGCCGTAGACTCGACTTTGAAGTACAGTTTAATTGCTAAACTGTGCAACGTA
TAGCCACAATCAGGCTATCATGGAGCGTCGTGGACGGGCCGGCTAGCGTCGGTCGGTGCTGCCGGCGAGGTGATGCACTTGGCCGAATATGCACCCTTTT
CATTGGTCAATTCCAAAAATATCTGCAGATTATTCACCAATCACATACCGGAATGCGCTTGAGAAACAGGAAACGTGGCAGCCTCCGAGCAGCGCTGGTC
GGGTGCAACTGGCTTCGATCGCCGATCTTGGATTCTACTGTCAAGGCCGAGCATGCTTGAAGCGCTGGTTGACCAACACACCCGCAATAGCGAGCACTCG
CTCTTCTCAAAGAACAGATTCGACCAGACCACAGCAGCCTTTCCTCTTCCGACAGTGGTCACGTCCTGTCAGCTGCGGCATGGGAGGTTTCGCGACTGCG
CCATCGACGCAGGTGCGTCGCCGCCGCATGGAGCGTTGGTGAGCGCTCTCATGGGCTCATACTCGGAGGAAAGAAGCGGCCAGTAGCCGTCGTTGCTGCT
GCGTCACGCGATCTCTTCTCGATCACGGCTTCCTCCAGCACCAAGCAACGCTCTGTCGCACTCGTCACTGTAGACCATCTTCCGCTACCATCCATCTCCA
CTTTCGCGCCAGCGTCATCTTCTTTGCTCGCTCGCGCGACACCAGCAGCGTGCACGCATTCTACCTCCTGCATCTCGCTGCAACTCAGCAACGAGTGAGC
TGGCGAGCGCGCCGAGGTCTCTACGTCCACGGCGACCTCG