Description :
Non Conding Region
Location :
Scaffold_1:82597- 83363
Sequence
766 bases(100 bases per row)
GTCTGAGAATGACGACGGAAGCCAGCGCCTTGGGCGCGCCCAGGTGGTGTTACACGCGCGCGATCTATACGCTGCGCATCCGGACGTGCGGCCTGTATCC
GGCGTTTTGGGGTCAAATTGCCTTAAAACGCTCCTTGCCGACCAGGCTTGTGAACTCTCACAGAGCCATCGCGCCCGCATGAACCGATGTGGTCTGTCTT
GCCTAGGTGTTCAGCAACTATCTGGCTGGCTGGCGTTGCTTGGCGTCACAATAGAGCGGAGATTTTGGCGGAGACTGCACCGTCCCTCCCCACTGGGTAT
TACACTGTAATTGTGCACGCGTATCAGAGCGCAGATCAGTCGCGCAGATGTATTGGTCTGGTACGCTTCGGCTGCTGCGACGGAACCGTGGGCGACCTCT
GTGGAGCGTCCTGGCGCTGCGCCAAGAACGTGCGGCACGCACGATATAGCGTCGTGGGCCATGCAGACTGGTGCACTCTGGTAGAGCAAAGGTGCTGGAC
CGCTAACACGCCCAACTACAGTTTGGGCTCGTCGTGCGTGTGTACACTTGAGCGTGGCACTACTCACGTGTGACGTAATTGACTTGGTCGGCAAGCCTAC
CTACTATGTACTGAACAAGGGAATTGTCTTTCTGGTATCCGGAGGGTGGAATGGCGCATCCGGACGTTCCAGTGTTTCAGCGTTGGAATACACTGTCCTG
TGTGGGATGCCGACGACCGCCACGACGCGAGGCGACCGTCGCGACGACGAGCCTGTAAAGACGACT