Description :
Non Conding Region
Location :
Scaffold_1:82584- 82755
Sequence
171 bases(100 bases per row)
tccaattgtcttcgttcggggctgctgccgcgtccgctgctgcgtcagggtccatcaaggcgccaacgattaagcctcgctttaaccctgttcaagctca
atctaaccagcttctccacagtgtagaggaagctgcggaagctccattcgaacagtagaaaccaagcgatt