Description :
Non Conding Region
Location :
scaffold_1:8254- 8438
Sequence
184 bases(100 bases per row)
CACTCCTTCTTAGCCGCGTCCGTCTCGCTTGCCAGCGCCTCCAGCCAACTCGAGTCCATCCTTGACGTTGCTTGAAGAGTGCAAATGTGAGAATGAAAAG
TATTTGTGATTTTCACTTTACCGGTCAGATTATTCCGGGAAATTTCCTAAAGGTAACATTTCATCTTCACACCTAGAACGATCA