Description :
Non Conding Region
Location :
Scaffold_1:82497- 84093
Sequence
1596 bases(100 bases per row)
GTTTCACATACTAGAGACCGATCGGCTGCTGGTGCTTGCTCACTCGATGGTTCAGCTGGTGAATGACCACCTTCCTCGATAACCACAGGGGAGTTTTTAC
TCCCATCACCCTTGTCTTCTTTAACGTTTCTGTCCAAATTCGACAGCTCCGGCTTGGGTTTTTGAGAGAACACGCTGATAACGGACGACGTCGAGGAGCT
GTTATCCAAGGCCATCGTCTGCAGCGCCGTCTGGACCATCAACTACAAGAACGTATTCGACCCCATCTACGGCTCGGTAGTGAAGCGAAGTAAAGTAGCG
TTCTTAGAGCAAAATGGTGTGGTATTTGTCCATGTAAAGCCTACTTAAGTAAGTTTCTTCTGCATACGTCACTCCTGCTCGCCTGAGCCTGTCATTGTTT
TCTCTTGCTCGTCGTGAACGACGCTATCTCTCGTGTACCAGCGCCTGAGCGACGCGGATCCGCTCATGCGTAGCTGCCGAAACAAGACCTGAGCTTTCCC
CACCGGTCCGACAATTGTCCTGGTGTATAGTAGCGCCGAAGTCGACACGGAGTCGGCAAGGAGGGCGACATCCGATATAACGCGACGGCCTCCAGGGCAG
CATCCGATATAGCTGGAGGGTAGTCATTTTGGCCGATTTAAAACGGCAATTCCGACCTGATGGTCAACTCGACCGAGGTTTAACCAGCTAAATCCCACCT
CCACCTGGGGTCCCTCGTCTTTATCTCTGAGCTGAAAATTATATCTGACCCGATATATCCGACTTCTGAGCATCGGAATTGCCAAAAAAATTGCAAGGCA
CAATAAATAAAGCTTAAGTTTGACCAACCAAAACTGAGTTTTAACACTTACCCAGCCCAGATAGATTTTTTGGAGATGCGATTTAACTAATTACTCCCTG
CAGCGGGTACTTATCTACCAGCCAGTTCTTGATGTTGCCATATTATGCTAGGCACGTATTGGTCGCTCTTACCTTTTCGACTGATGTCGCTAATGAATAT
GCATACTTGTCTAGTATAATACGCAACACCTTACTTGCATTATCCCCGTCGATAAGCCGATGGGGCTTCGAGTGTCATGCTCTCCGCGGCCAAGAACGTC
GTGAACGAGTTAATCGCCGTCGTTCTGGCCTTCTTGCTGTTAGCACGACCAAGCGATGCGATCGAAATGCTAGCCTGCCTGCTCTTTTCACTCTAAACGA
AAATCTATGTACCGACCTCTCGGGTTGGAAACTGACGGATATTTTTGGGATATGGATGTATATAGTGGTTTTTCCGACAGATAGCTTTGCAGGGTTTGTG
CGATATATTTGATATCCAATCAGAAGGCGTAATTGAAGACGTTTTAGCCAATGATATCAAAGTGTCGTTTTTATTGTATTCCGACTCGTTCCGACATATA
TTTGTAGGAAAGCCGCCAGGAATATGAATATGCTAATACAAATTTCAATATAAATAAATATTGTTGGCAGATTTCAACAATTCCGCGGATTAGGCATTAT
CCTAGTCTAGTATCGCTTACGTTAGGACTCGCATTGGTGGCTAGGACAGCTGATCATACTTACACAAAGCACTGTCAAAAAGCAGAAGAGCCGTCA