Description :
Non Conding Region
Location :
Scaffold_1:82230- 82368
Sequence
138 bases(100 bases per row)
GTCGATCGACTCGACACCCTTGAATGATCGAACGATTATCAAGACTCGGAATACATCGAACAATCGGGTCAGAATGATTGTCAACATGACTGGATCCTTC
GATATTTCTCGGGCTTCAGATCTCAAAGGAACGAGCAA