Description :
Non Conding Region
Location :
contig_1:82152- 84483
Sequence
2331 bases(100 bases per row)
ATCGTGGTGAACAGCGTCGGGTCCGGCGGGGTGGGCACACACGACGATCATCCGTCCAATATGGAGCCCAGTCGTTGTTAAAGGTAACTGAAATCTCTGT
GGCGAGTTTGCCGTCGCGCCCCTTTACGTTGTAGAACGTGTACGTCTTCAGTGGCGACCCTGGGTCGTTTTCACCAACAGCAACCGCAACATCGACAGGA
GTCACGATACTCATCTCTCGATCGCTGCGGGTGTTGTAGGCGAGTTTCGCGTGGCGTCTGCTCAGTAAACCACGAAATGAAAACTGAAGGTTGAAGCGTG
ACATGAAATGAGTGGGGCCAAGCGCACTTGTATCGGAGTATGCGTCCAGACTTAATAACACTTGGCTGAGCTGAGTTTCCTGGAACGTTTCCAAACTCAC
CTGAGGTGAAGTTGATTCTACATGAACAGTATTTTGGGGCGGACGCTGAAACATCGAGCTCTGTCGCAGGAAACTACTGCGAAGTAACCAAGTACTTGGT
GCGTTTCATTGCTACAATTACACTTACTTCTTTCCTACAAAGACCCCAACACTAGATCCACCAAAAATCAAACCGCGAAAGGTTTCAAGAAAATATAATA
TGGGATCGCAGACCTGCGTAATTTACCAATTTCTTTGAGTCGCAATGTGTTTAGTTCAGGAAGTGGGGATTTACCGTACAGCGGGTGGATTAATCAAACG
CCACCCAAAAATTACTAATGAGTTTGGATGAGTAGATCGCAAAATGGAAGCAAAGGTAATTGGAGCTACGAAAACGCATCAAGTTTTTTTTTTTTTTTTT
GGGGGGGGTTAATGAGGTCCTCTGTTCGTGTTTACCTAGAGACTATAGAGCCCCAAAAAGCGCATCAAGTTCTTGGTGCTTGCGAGGTGAGTTTCTTGCG
AAAGAGCGCGATATAAAAGGAGGTATACCCTCTTTGAGCTCGCTCCCAAAATACAGTTCACACATCGTTGGAGCGCACCGCTCGAATTAACCATTAAGAT
GAACGTTCAAATTTTGCGAAAGATCTGGGAGCTTGATGCACAATAATACTGCGCCTTTATCATACCTATTATTATTTTCTTTGCGTCTATGATGCTAGGG
GCTGCTGCCGTGACGTCGTCGCTCGTAGTGAAGTCTCTGAGGTAAGTTTTAATTAACGGAAATCGATCCAGCACTTGAAACCCCAAATTCACCATTAATA
TTAAACGTGTCTCGGCACTCTCTCCTATTTCTTCGTACGTAAAGTACAACGGAAAAACCGCATCACCGTCGAGACAGTTTGTCCACGGGGTACGCCAACT
ATGGTAACAACGAAGCGTCTCTGAGCTTGCGTTCTTGCCGGCGATAATCGTCCACCATTGGTAAATAAAACTGTCTCGCCACTCACTCCCTCCTTTCAAG
AAAATGCTTTACAATTGTGAGGGCTTGACTACATGAAGTACAACGGACTATACTGCATCCCCGTCGAGACAATTGTGTTCACGGGGTAACCTCCTCGACT
ATGGTAACAACAGCAACGAAGCGTCTTCTGTGCTCACTCATTCAACAGTTTAATCTTGCGATGGCATTTGGAAGCATGAAGATAAAAAGGTAGCTCGTGC
AATCCACGCCATCCAAATAACTGAACACGATAGCGCAACAATAAACCATTTGGTCAGCTTGAGGCTTGAATTTACTCGCTTCCAAGTTATCAAATACTAC
AAGGGTTCATTGTTCACTTTAGAAAAATAGAACGCCATCGTAGACAGCGTTGGAGCTGAATGCGGTACATGAAGAGACCCCGTCTCCAACATATCATATC
AGTTTGTTTGCACTATCGACATAAAATATGAGAAGCGTCTAGAGTTTGCTAAAATAATACTATTTCTTATGAAAATACCAATAGTCTTTTTTTAATATTC
TGCGTTCAAACCGCACTGCTCCAATATTTCTTCTGGAATGCCTGCCAGACAGGTATTGTCTTGCATTTAGTACATAGCAAGTATCATATAATACATGTAG
AAAGAGTAGACGGCTTCGTTCTGGGTCCCAAATGGAAATTGTAGATCAAAATGAGATCAAACTAGAATGCATCACCTTGTGTATGCCTTCACGACGTACT
TCTCGTACATTAAAGTCGTAGGCAAGAAAGAAAGTGGGTGTTGCTTATTTCATGGGCTTAGCAAAACGTGAAGCGAAGCGATAAACCGCACTCTTAAAGA
ATGATCCCATCAGTTGTTCAATGTCGACTGGCTGACAGCAGCCTTCTCTCCAAAACTTAGCAGTAGTAGAGACCGCCGAATGGGATGCCCAGACCGCAGC
CGCCGCCGTACAGACCAGCACCATACATGTT