Description :
Non Conding Region
Location :
Scaffold_1:81824- 82017
Sequence
193 bases(100 bases per row)
CAGCGTCTCTCGCTCAGTTTTGATCGAGATAGATCTCATTTTCGGGTGGgTTCGGCGTCTCCTTAAACTTGTCCCTATTCAATGAATGTGCCTTTGATGT
CGCTATGATCATCTCAAACTGTACTGATGCTGTTAGATGGAGAAGAGTCAACAGGTGAACAGGACTGACTGACTGACTGACTGACTGATTGGC