Description :
Non Conding Region
Location :
Scaffold_1:81694- 84417
Sequence
2723 bases(100 bases per row)
TAGTTTGAACGGTGGGTCATGGCGAACGTCCCTTCTAACGACGGCACTTGTGAGCACCGAAAGTGAACCAGGAGTTTAACAAGGCGTGAGAGACTGTCGA
GTGCTGCAGGTGCAAGCATCTCGGTAGTGACGGATGACAGCAGTAATGACACATGCGACCAGATTTTCTTGCTTGGGTAGGTACCATGACTAACGAAGCT
TGTACATGTGCTGTAGTTGTTGAACTTGAATGCCGCAGTTCAAGTGTATCGAGCGTCGACCTTGCCGACGCACGTTGCGCGGCACGAAGTTGCTCACGCC
AGGATAGCAGGAAGCGCTTTGATCCTCCATCCTCTACTTTAGAACTTCTCgctgaggaagctcttggtTCTTGCCCCTCGGTTGTTTGCGGCAGTGCCGA
GGCCAGTTCCAACAATCCCCATGTCTACAGCTCCGTTGTCCTAGCCAAGAACGAGATCTTTGGATCAatagcttcaacttgcacaaggctgttgctgtgt
tACAGTACATGGTATGATAGGCCAAGTCCCTCCACGCTGTCGCCTCCAGCGCGAAATGAAGTCATGCGCCTCCTCACGCCTGCAGCGCGCATAAGGCGGg
cctggagctcttcgagctctCGTGTGCGCGACCATCCAAACGGCCTTCCGGCAGAAAAGGGCAAAGTCCTCTTAGCGTCAAACACACGGGCGAGGCCAGT
ACAGTGTAGCCTCAGGCTACTGGCGGGCGAGCCTGCCGTGAGCTCCAGAACAAGAGCGCGGCCACGGAGATGGAGGGCGGCGTAGTTAATTGAGTGGCAC
CGCGCGAACGAAGGCGGCGCGGACCTCAAGcaaggagctcctgcagccGAGATGCTGGCATCGACACGCGTGCACAAAGCGGACGCTGCCACTACAGACT
GTAGTCTACAGTACGGCTCGGTCCGCCCCGCCGGCGCTTTCTGCACGCCAAAGCCCTTCTCTTGCATTGCGGAGCTCGTCACCAAGATCGCGGGGCGATA
CAAAACGGATGAccgccaagcagcaaaaagtCACTTGTCCGGCATGACCGGCAATTGCCGCCGCCACGACCAGTTCAGTTGCTCCTCCTTATAATTCTCT
ATACTTCGCGCATGCAGCTCAGTGCCGGCATGTACGGACTAGCGGATCCCGAGCTCGAATCCTACGAGTtggcgccgtcgccgccgcgCTCCACCCACCT
cagcgtcgtcgacgacgttcgGGGCTGACGAAATCGGGCGTGCTTTGCAATCGTCCTGGAAACCAGTTGCCTTGGGGAGCGCCAGGCGCTCTGCGATACG
CGAAGAGCCGGGGCTCGCCAGTCACCTCATCTCGCCTGGATCAAGTGAccgagctgctgtttgcCACGTGCAGTTGTCGTCGTTACTTCAAAGCGTCGGG
CCCCACCAAGCGTTGATGACCcagatgagctgcagcgcaatgtCCGCAGGTCGAGCGACGGCTACAGCCACCAGGCGGCGCTGGCACCAACGCCTTCCAG
CCGCAACCAAAATGCTCGCCACCTCGAACTAATGAAATGTAGCCACGTCCGTGCACGGTGTTAATCTCGGCGCCGCGGTTTCGTAGCGCCATCGGAGACG
ACCGCCGTGGCTCTTCTCGCTATGTCGGGCACGCCCTTGCAATTCTGAAGTGTAAGGCAAGGCCTCCGCCACGCGCGACGGCTTTGGTTGAAATGCGCAC
CAAAGCGGCCATGCCGCTGGACGAAAGGAGAGACCGGCCACTGCTGGCATTGTCGAATTGACGCGACCGTTATGGGTCTCTGTGGCGAAAAGGGCCACGC
AGTCACTAAGATCCGTACAGGTCCTGTTGCGTTGCCTTTCACAGCAAAGCGAGCATGTTGAGAAGCTCTGCAGAGGACCAGCATTTTGCAGTGCAACCAC
ACCgtattgctgctgccgagcCGTCCAAACGGAGTTGAAAGAGGGCAACGCACatcgtgcaggagctcgctgctgttctcgCGGAGCCGTGGCTTTCACA
TCGCCGCTGATGAAATCTTAGCCATACAGTTTGACTTGCATTTTGGCGACCAGCACGCACATTCCTATGACACGCCCGTTAAATCGTTTGATCCATCCGC
CAATCACAGTGCCGTTTGCTCCGTTTGAATCGCGCGCGAACCGCCGCGATTGGTTCATCTTGCGCTCGGTGCCTGCTCTCTTGTCACGCATCACGCGCCA
GAAAACGTTCGGGAGGATGGGCTGGGACACGCGAAGGGATCTGGACCGGCTTTGAGCGAAAGGGGTTGTACCTTTGCGACCGCGTCGTTAGCCGTGATTG
GATGGCCACACTAGTAGGAGCTGTGGTTTTTTGCTGGACGGCCAGCAAGTTTAGCAGAGCTATctctgtcgctgctgccgcgAGCTATTTTGCTGCTTGA
CCTGCAACTGGAGCCAACGCGCCAACCGCCGTATCAGTTTGACACACGTGTCTCAAGAGAACAGCCACAACGCTGCGATTCATTTATTTGAATCGCAGCT
GCTCCCCTAGCCGCCGCGGCTGCCCCTTCTTTCCCGTCTGTGCATAGCCAGATCTCGAGGGGGGAGGGCAGGCTCTGCTTCCGAGCTCCAAGTGAGTGGT
CGTCCTGCGCTTACCATTGTGTTTCCTACCAGGCCGTTGGTACtcgcttcgtcttcgctctcgcGGTGCCCGTCTCCGAGGCCGCAAGTATTTtttctgc
tggagcaggGGCAGCTAGTTTTA