Description :
Non Conding Region
Location :
Scaffold_1:81528- 81830
Sequence
302 bases(100 bases per row)
TCTGCCATTTAATGATGCTCCTAAACCCATTCAATGCATACAGTTTTTATAGTTCAATCTTCGTGATAACCACAACCTGTCTGTGAAACTCACTTGAACC
CTGGCCCTATATTGACAAGCAATTTCCCGATGGCAGTGTCCGAGTAGCTTCAACGAATGACCTAAATGGGCATAACAGATTCAATCGACTACAGACAACT
AAGTGCGCGCCGTACACGCAGGTGGTTTTGCCAGCACATGAGTGGCTCGCCCTTCGAGCCTGTCATGAAGACGTCATCTCGATTCCCATAATCTTTGAAA
GT