Description :
Non Conding Region
Location :
Scaffold_1:81164- 82666
Sequence
1502 bases(100 bases per row)
ATTGTCTTCACCAATGTGTGTGCCTCTTTATAACACTTTCTTTTGGCATTTCTTTCTACGATCTTCCCATAACACTTAACGAGGTATACACATGAATTTT
ACCAGCTTTGCTGTTGTGTATAGTGGGATTTACCCACTCATCTGTATAGTGTTCAGTGCGACTGCATAACGGAAGGCAAAAGGGTACATCTCGGCTTCTG
AACCACTCGCCTTCAGTTTCTTTTTGATGGTGGGTGCAAGACGCGCTCATGCACATCAATAACGACGTCCATCGCCATAAAGAGACTAGAAACAATGAAG
CCATGGATGCAAACAGGGGCCACATAACGTTTTGTGTCCGTTGCGAGTCAGTCAGTCAACGCGCCGATTTAAAGAGCCGTGTGCTTATCGCACATTCGTG
TACATATTCAGCTTTGTATCCAGATACACAAGTGACGCTCAAGCAAACAACAACCAGGCGGATTGAACGCAACAATAGCGGTATCATGGTGTATGGATCG
CGCTCTGTATGTTGTTTTCACTCTGAATAATGGGATGGTACAATGCAAATCGTTGAGCCGGTCTCCTTTGACAGGGTGATAAGTTCAGTCAGAGAACAAG
TAAGGCGCCCCAGATTTCAGAAATCTGGTTATACATTGGAGCGAGCGGTTGCGCATAGTCATGCCAAAGCATCGAAATGATGAAGAATGTAACGTCTTTA
AACCACTCGTTTTAACAGATCATTTCTAAAAAAATGCCCCAGGCACTTGATGAGAAGCATGGATTCTGAAAACAGAGGCATGGACGGATGGGCGAAGTGG
GTTCAGGGATCTGGGATTCTAGTTCTAGCCTTTAACATCTCATACGCACAGTGGACCATGCCCACTTGACCAGAATTCACATATGAATACAACAACAAAA
AATATGCACGGCTCCGAGCCAGTCCGTGTCAAGAATCGAAAAGAAAACAGAAAGCATTTTCCACAAAGCCATGCTCAAAAAGCGCGCGCACACACAATAC
GCTCACAAAACACAGCTTCCATACACACATACAGTATCCAAGCACTCACCTGCCCCCTTATCTGGATATGCATTCTGCCTCTTTCCATCTAGATCTGGAA
GGTGACGTTCTCTTCGCGCTTCCAAAATTTCGCTCTTGTATGTACATACCCGCAATACGAGTGTGGATCCGCTGCTCCGTCCGCTCGGTCCGCTCTTTCT
TCCGCCCTTGTGCTCGCATACAAACTCCCAGTCAAGTGCCGCCCCGCCGCGTCCACCAGAGAGCGCATGCCCATAATAAAATAGCTCTTCGCGGAGCGTT
CTCGCAGCGTCGCAGATCGTAAACTACACCCGAAGACGCAGCTCCTACGATACGATACAATACGCGGCCATCTCGCGGCTATTACTTAGTGTGCTCGTTC
CTGTGTCGAGAGGAGAACCCCATCCGCGGCGCCTCGCGTGAATATCCATCCATCATCCGCCACTGCTGCGCGTGTTGAGCGAGCCGCCCTGTCTGTCCGC
CA