Description :
Non Conding Region
Location :
Scaffold_1:81106- 81219
Sequence
113 bases(100 bases per row)
ttgatctttagttttagaaatgctattcacagcaatttagaaattaaaagtgaatttctattcaaaaatgtagccattcctaaagccattttacatgacg
atggcgtcctcgg