Description :
Non Conding Region
Location :
Scaffold_1:80748- 82569
Sequence
1821 bases(100 bases per row)
AGTTCTCTTAAGCGGTTTTTGCAAACGCATCTCTGCGGTAGCGGCGGGGTAAACGGGTTGCAGCAGGGACCTTGAGATCAGCCATGTGGGCGACGTCAGA
GAGTGATGGCCAATGAGCAGGCCTACATCCCCAGCACCGCACTTTCTGGTGCGCTGCCGCACCGGCACTAGCACCCCGACACCGGATTCTGTTGCAAATC
AACACGTGACGTCCTGTACATCTCGACACCATAAAAAGACAAAAAGACGATTTAACATATACACCGACAGCCCTTTACCAGCACTGCTATTGTCCGACAA
TTGAATGAAGGCACAACAATGATGGCTGCGCTAATAGGATCGCCTCGATAGATACACTTAGCAAAACCCTTATACAAACATGCTCCCGCTACATTTGCTT
TTATTGCCTCTGCGTTGCGTACAGAAAGTAATAAACGCATCTTCTCTGGGTGAAAGCATCCTCCGAGTCTTCGTTGCATCGCAGCGCTGTTAGGTGGGTG
TATTATACACTTTATACAGTATTCTACAACAAATAATGTACAGTAGCACACGGGGGCTATTACATGCATACTACGTAGTAAACTCCAGCCTGGAAGAAGG
GCTTATATGTTCGATTCCACTTAACATTACAGTGAACTTGAACACAAGTGCAGGTGCTTGAAGCAGCAAACGCAACTTCAAATTCAAACTTCGACATCGC
GGTCGGCCGGTCTTTGCAAAAAAGGTTATTTTGTACATGATCACTGAATGCAGGATACTGTCCAAGATAGATTTTTTTTGCGTGTATTTTTTAAGCTAAG
GAAAAGCCCTAGTAGGCTAAACGATTCAAAGCGAATACTCGAAGACTACCTTGCTCCTATATGCTCAGCGAAGCCCTCATTAAACTATGAACGGTGAGAG
TGGAGCGATTGGTGGTTGCACTAAGCTGACAAGGTTGCAGAGAGGTTGCAGAGAGCATTCCCGCTCCACAAAACAGCCGCGGAGCTCATCCTCCACTGAC
AATGCAGGTGTCGATAAGACTTTGGTATGATTCGTACTTCGTTGCCCGAACCGGATCTCATGTTCGCGGCTGTTGAGGATCCCAATTCGCCTTCCGAGTC
GGGCGAGTGACTATTTGTCAGCGACAATGCTGACAGGCGAAGGTCGCTCATCCCTAAAAGGATTCTCCTGATACTACTGGCAGCCACTGGCCGTCTCATT
TAGAGGCACACTGTGTCCATGCCATCGCACCGGAACGAATAGGCATTGCCATAACGCAGCTCTCACACACGCTCCGAGTGGTGAATCACCTCATGTGATG
CAAAAAGATGGATGAGCGAGGGTATCCAGCGTCTTTATACTGAATTAGCGAATAATCCAATTCCTGAGGTAAGTTGAATAAGAGAAACGCGAACTACAGC
CTGTAGTTCGCGCTGTAGTTCAGCAGGAAGAAACCATATAATACTTCTCCGTTCATGTTTTATGCAGTAAATTCTTAATCTGCAATATCTACTCTTTCAT
TCCGCTCTGGAATCTGCCCACGTCGGCGCATTATCTCGTAATCCCGGGAGAAAAAAAAATGTTATTAATGAACATACCGTAATGACAGACTATCTACTGT
TGTCATTGGAGAGAAAAACATGATGAACATATTCACCGCGGCGCGGTGCTATATCACAGCCCAAATCAGATTAATTGTACGCACTGCTATACCGATATCG
TGTCGGTGTCCAGTATTACTTGAATGTACCGCACGCACTGGATCCCCCCCCTTGTTGCTGGGAAGATATTATAGTAGTCCAATGTGCCTTACACGGTGTT
GTAAATCGAAACGTTAGCGTG