Description :
Non Conding Region
Location :
Scaffold_1:80649- 80807
Sequence
158 bases(100 bases per row)
TATTCGCATTCGCTAAGCGAGGTGTGCGGTGCTGTTGTATGGGCGTTGGGCTAACCATGAACAGAGTTTATATTGTGTTATGCTTCTCCATCCTCGCGCT
CTGTTATTGGCACTGACCCTCTCTTTCCTATATAGTCAGATCAGTTTGTATCTTCACT