Description :
Non Conding Region
Location :
Scaffold_1:80603- 82538
Sequence
1935 bases(100 bases per row)
GTCGAGGCGAATATCTCGAAATGCAAGCCAGCGTCTCGCGTATAGCTACTAATTGGCCTGTATTCACCACCCGATGTGATTTTCTCAAAACTGTTCATGC
GCAATGCCAGATCTCACATCCTTTGCCAGAACAGTGGGTAAGGATCTATCATACCGCCTGGGTACTCGCGCGCAAAACGGCGTCTACTGCCCTGCTTCGC
GTGGAGCACTGTATCGTGGCGAAGCTGCGTAAGAGACGCAATTTGCGTATTCATTTGGCGCCACCGCCAAACATCCGAGTGAAAGGTGCGAGAAGCATTT
AAAAATGGTCTTGACAGTGCTCGAAGCGCCCTGAGCCAAAGTGTGTTGATGCTCACGTTTTCACTCGCAGTACTAGTATCCTTGTTGTCGTCACCAAACT
CACCGTCGATCACTTGGCGCAGTGCAACCAGATTGGACGCATACAGGGATCCTGTCTCTGTGCACCACAAATGCACTGGTATCGTTCTCATCTGTATTAT
CTTGGACCGTCATGGGGCTGGGCAATTCCTTCCCCGCTTCGTTGTTGCCAAACAAGGCAAAGGCGACGGCGACAGCGCTCGGAATGTGCCGGGCTTGTTA
GTTTCTCCATGAATCACTTGATCATAGACCAGCCGGGTGAATATGAATGCGCTCCACACAAAGGGCTGGCCAAGCAAGGCGAATGAAGCAGGGGGGGCAA
TTCCCCACGATTGCCTCTACCACGTTTCCACCCAACGAAGGAACAAAACGAGCAAGTTGGTGGGCTGAAAGTGACTCTGCTCCCAGATCGCCGTCGGCGA
TCAGGTTAGATGCTAACGCGTCGACTTTTTCTAAATCGTTCAAAGTCTGTGACTCTTGTAGGAAATTCACTAACAAGACCGCGCAGAGCAGCTCGTGGAT
ATCTTGCTTCGGGTCCTTGCCGCCCCCAACCCGAAGGTCAACTGTCCCGAGCTACAGCATAGCACGAAAGTAGCGCTCCAGTTTCTCAGTTAAGGTGTAA
TATCCGCGTGGCTTGAACATTGATTTTTCAACAACTTCCACTGAGGTCCTCAGTGGATGCCGTTGTCTCTGCCTGGACAGCCGAATACAGCACTTCCAGA
CTAGCACTATTATGTACAAGTTCTCCACGTAGTAAACTCAGCCCCATGAAAAGGAAAACCTCTACACCCTGCATAGCCCTCAACAAGTCAGCATCTCCCT
CAGAAGTCTCAGTACCCATTGCAATACACGTGGAAAGAGCCGAGGATAATATTTTCTCCAGTGTCGGAGCTGCTTCAAATCGATCAGAAAAGCATCAAAA
CTAGATGCCACGCATGCAAAATGGAGTCTGCCATCACGAAGGTATGCAAGTTGTCCGTATATAGTCGATAGTAGATCTCTGCAAAGCCCTGAGTATGCCA
ACGTTTCAGCACTACCACTCCATTAGCTGCCAATTTGGCTTTCTCTTCGGGCTACAGACGAAAGTCGAACTTCTATTTATTTTTTTCAGTGGATGGTGTT
GTTCGGACATTTCCAACTGCCTCACGTACTCGGTTCGATGCTgctcttgtgcttgttgaCGTAGACGCCCCATCTCTTCTCTTAGCCTATATTGGGTCGG
CGTCAAACAGATCGAAGAGCTTGCACTTCGCCAGTGCAATTGACTCGCCAGGGTTGGAAGACAGGAGGATACATCTACACAAGGTCTTTGGTCGTCAACG
ACGTGTCATTGCGCTTCAATGTTGCAGTAAATACGGTCCCAACGTCACCTCTGCCCATAAAAACTTTTGTCGGTTCTCGACTTGTTCACTAcaaagcaaa
ttgaagaatgaagcCACTTGAATGGGTTCAAAATCAACTATAGTGAGACCAAGTGAAATGGATGCAATTCTTTGAATTGAGatccaagttgaagttgaag
tgcgcATTCTGAAGTGCGCATTGCGGTGACGAATA