Description :
Non Conding Region
Location :
Scaffold_1:80442- 80488
Sequence
46 bases(100 bases per row)
gttggggaaggtatatccaaccttgaaattaccatcgactttgtgt