Description :
Non Conding Region
Location :
Scaffold_1:804- 9046
Sequence
8242 bases(100 bases per row)
TAAAACGCTTTGTCAAATTTGGAATCTTTTCTTGGGATGTATTTTTGGCCGTTGCCGTTGAATTTTTTTATGAATGAACCCCACTTGAAAACATAATTAG
TTTTTCAAAAATAACCTTTCAATTCGAGCAACTTACCCACTTCAGGTTTTACTACGAAGGTTGCAATGCCACAGTTAGTCGCAAGGGGTTTGAGACTGCA
GTCAGAAGTTGCATTAGACTTAATTTTCCTAGAGCAAGAATTACAAGTGAGGCTCTACGGTACCTTCGCCTTGACCTCCGCGCTGAAGTCTCCGGGCACA
TCGGATTCCCTAGTGGCCTGGTCGCTACCATCGCTGCACTTTTGGAGCTGGCTGGACGGCGTGTTGAAGGCCGTCACGTCCTAGCTTGGCGGGCTCGTAA
ACGTGGTGAGAGACCGCAGACAGCGCAAATTCCGAACATGACCGAAGCGATTTTACCGATATCACCCAGCGTCGCAGAAGAGAAGTCTTCGCCGATGAAC
TCGACAGCTACAAATACTGTCCCCGATGAGAAGCCATCCAGTTTAGAAGAAGCTGCCCAAGCGAAATCGTCAAACCTAGACGAAGCTGCTGAAGTGAAGC
CATCCAGAGGAGAAGAAACTGCCGAAGAGAAATTGTCCGAGGGGGAAGAAGCCGCTGATGAGAAGCCGTCACCGCATGCTGACAACGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGTTCTATATTATTTCCGCAGTGTCTTGCGTGTTGGTGGCATGTACTCCGCAGAGCGTGTTGCAG
AACAATCTGAACTCTTTCTTCTCGACAAGACTAAACGGAAGTGCGTTGGATAAAATCAGGACTATGAATTTGGAGTCAGTAACTGCTTTGTCAAACATAC
GCTGCCTGACATACCACTCGAATCTGAAGTTAAGTAAATCCGTCTGTCGGGCACCGTTCGTACCCTCCACAGCTTCGTCATCCCTTCCATATACCTCGTT
GTGCCATATCTGTAAGTGCCGTCAAAATGTGGTTTGAGCGCAGCTGTTTCAACCTGGAGCGGTGTCGGCAAGGCATACAGACACGTGAGCGTGCCGTCCG
CGTTTGAGTAAATGTAGGTCCATATATCTGAGCATCTCAGATTGTTAGTGTGCCTTATACTACTTGACCCGGTATTTGTGATTGACTCGACCTGACTCTC
CATTGCTAATAGTGGAAACTGCGGATGAAGTGAATTAGGAAATGAGCTGGATCGCAGCGGTGCCCTGTGCAGACCACACAGCGCAGGTGGCGCCGATTAA
CAGAAAAATGAAGTATGACGCACCAACTACACATCTGATCGGATCGAATCCGATCTAATCGGATCAGATCGATATCTTGTTCAACCACAACACACATATT
TGGCAGTGTAGCCGGGCAGGGTGCAGTGTTGAATGCCTCGCATCGCCTTTTGTCTTCTCCATGAGGTTGTCTGGCGCTTGTAGTTAGCGTGAAGTCTCTC
CAGGACCAATTACTAAGTGAACTGCATGTCGCAGCCAAAACCTTTTACATTTAATGAAAATTCATGTCGAATAATTTATTTAAAATTGAAGGTACTGTAG
CTTAATTGGTTAAAAGACAAGCAAGCGCCTACTAATCTAAGTCTTTACACCCTAATACCTCTTTATAGAAATCCGTCATTGATCTGTTCCAATACGCTTT
TCTGTAGAAATTTATATCAACCAAGTCGGATTCGATCTGCCGATCAATCGGGTTCTATCGAAACAGATCGAAAATCGGATTGAGCCAATTGGATTCTTCA
GAAAACATATCTCAATTGATCGGATTGTGTGTACTAGTCCCCACGAGAAAACATGACATGATTACGTTATCGTATTTTGATTTTTTAATCCGTAGTATAC
ATTGGAATATATGGCTGACCAATAGCATTTTTGACTTATTACTACAATAGATAAATTATCCTGATTATGGTTACATTTTCATTGATTATGGTATAAACTA
CTGCGGAATTATTTTACATATTGGTAACGTATTGGAAGGTTATTTTTTTATAATGTACCAAAACACAATTTGTTATATTGATATTGTTTTTCCTTCTGGT
CCATAATTTAATGGATTGTTTTTAATAGACGTATGGTATACATACTAAAAACATTGGTAACCACTGTGAATATTCTGCGGACCTTCCTTTAGCAACGCTC
GGCGTGTCTTGTACAGCTAACAGGGTGCAGAGATCTTATGCTGGTGTACGTCAATGGAAGTATAGCAATGGGATAAAAACCAGAGCTTCCCTGTGCTAGC
ACGGCTTTATTTACAATTACAACGATGCCTGCGTCAGGAACGCTAGTCATTGAATAAAATCCGAAAAAAAAAGCACACATCAATGTAAATGTGCGGTGTC
CACATGTGGTGTGCAGCCACTGCATTTATTAGTAGTGTGTTGAAGTAACACAAAGGATACTGTCGCACGATTGTCTTATGGTATTCAGACATTAGTATCA
TTAAACATAAATAATGTGCTACCCATTGTTAGCCGTCATGGGTCCTTGATCAATATTATAGAGACTGTCATGATGAACTGAAGGGATCAGCGCCACAGAT
GCACAGATCTCATCGAATATTAAAGGATATATGGAGGTAGTGGATGCGGCTAATGCGGGGGAGCTCTGTATGGTGCTGTTCTGTAGTTGTGATGAGTTTA
CGACGTTCTCCCCAGAATAATCTGTATTCATCACTGAAACACGTCAACGGGGTTCTGTAGGTCATCTTGTCGTTGTCTGATGAGACAGGTTACACCAATC
ATGCGGTCCTGGTGTGGTAGAATCGCATGACTATTGCAAAGTGGCTAACATCTTTTTCGCAACTATTGCATAGTGGCATAGTTTGCCATCCTGTGTTGTT
CACTAACATTAAGGGGTTCTACGACCGACGGGAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGCGCCCGACTCGGGCGCCGTGAACCAATAAAATAAGACCTACTCTAATT
GGTCGCCGTGCGCCACGGCGACTGTGTGACGGTACCCCGTCACCCCCCCCCTCCCCTACGTAAGGTTGAAGCTGCGACGACTTCCAAACAGCTTGGTGAG
CTCTTCACAATCGAAAGAGCCGCGACAGCATCAGTACCCACA