Description :
Non Conding Region
Location :
Scaffold_1:80369- 80449
Sequence
80 bases(100 bases per row)
TCGTGGACGACGAGTGCATCGTGGGATGAAACCAGTGGTTAATCTCTAACATTGTCTTTCTTTATTGCTTGCAGTGTTTC