Description :
Non Conding Region
Location :
Scaffold_1:80294- 83783
Sequence
3489 bases(100 bases per row)
CTGATACTTGTGAATTAGATTTGGACGATAGTGAATTTCCAATAATATGAATACGTGAACAAAAATTATACAATCGCTTCAGCCAAATAATTTCAGAATG
ACCCTGCGCCCGAAAGCAATTACTCTTCAGGTTCTCGTATGCTACTCAGGTCTTATGTGTGCTTATAGTCAGTCGGTAACGATAAACCTCGAATATGGGG
TCAACCCCGCAGCATCATTATAGTTACTAGCGGTTCCCATAATATGTCTCTATGTCACGGGATTGCAGACTACCTTGTCTATAATGCAAACCCTGTAAAA
TGTGCTAATAACACAGAGAGTATATGGTAGATAACCAGACGATGCTTATGCACGAATCCATGCGTAAGAGCTGGCACCTTTGGTGATGTCCTCTTTGTTT
ACCCACTGTTGTCCTATTGTGCAAATAATTATCCGCCTGGCCATTATAAGATGAGGGTTTATATCGCATCATACATTTTCGCAATAGTTGGAAATAGGAC
CAGGCTGATCAAATAAGCCAGAGCAGGGAGTTCATGCTGTCGAATTCAACACGCTAGATTAGAAGGGTATTCAGCACAAAGCACGGTCAAATGTAGGAGG
ATGTGATCAACAAGTTTTGACTTCCTTATAAATGAATGACTGGGTGTACCAGGATGGGCTCGGTCAGTTGTGAGGGGCAGTTGCACGTGGACATATGATA
AGATGCAAAGTAGCTTTAATCACCCACAAGATGGGAACCAGAGATTGAAATCAAGTAGCTTGCATTGTAAGGGAGTATCAATATGTTTCCAAACATTCTC
CCTCCAGTGCGCCAATACTCATTGATTATGATCAGAAAGCTGAAAGGCGACGTGCATTTTTAAGGTTTACTCTCTCATCGCTCAGTAAGCTTCTGGTCAA
ATCTAGTTGACCAAGTATGTGAAAAAGGAGCACTTAGACCAGCGAATGCAATGGATCCATTTTGCGAGAATTAGTCTTTCAATACCGCTTGTGGACTAAG
CATGTAGAGTCAGCTCGAAGAGAAGTTTATGCAGCTGTCACACTATACCGCTCAGTCGCTCACATGCTTACAATGATGTCCTTTGGGTGAAGGGAATCAT
ATCTCAGCAGCAACTATACACCGATCGCAAGAGGAGCAAGCGTAAGGGCTTGCAGGAAATCCACTCATCCAGTGCCCCTATCGCAATACCATGCACACAG
ACCGTCCTTCAATTCGGAGCATTGAGTTATCATCCATAGACGCTAGCACTGCGGTTTGCATAGTATGGAATCTCTCGACCCTTTGATGGGCTGGCTGTGC
GGTGAGTAGAGCAAGTTGTTGGTTGAGATCAGCTGGAGGGAGCATTCTTGTTCTTTGGAGCACAAGCAACATAGGCTCAGCTGGTTTATGCGGGCATCCA
GCCCTCGAATAAGATATTCTTACCGACTTTACCCTGGAATCAGCTCTTTCGAGTTGACTCAACGCGTACATTAAAAGCTACCAGCACCTGTCTTCCGACT
ATAGCAAGACAGGTGCTTTAGTCGAATTTTTTTCCTTCTTGGATAGTTTTCTTCTCAGTTCGACATTGATGGCCTCTCACAGCATGTGCACGGCTGCCCA
CTCTTGAAGATGGTTAGATACCTTTCCTACTGACTGCATGTATTTCCAGCGATTACATGTGAGTTTGTTTGGACAGATCAAAATCGAAAGTCTTTTGATG
AATCACCTAAGCTCCGATTGCTCCTGCTCCTGGAGAGAGACCTCTGAGATATTCACTACCAATGTTCGATTGCTTCAATGGTAGCGCTGCTATCCCGGGA
GCTTAATTGAGCTGTGGACCTCTGTAAAAGGTATTCACGGTGGATTGATAGACGTCATTGCAATCTTACTAAATTGTTATAAGTGAATCATTTTTGAAAT
TTCGCGATTACAAAATCAACGTAATGATTTATGGACCAGTTCGGTATCCATCTCGAGTGAGAGTCAGAGTATCTTAACTATATTTTCAAGCATCTTTCCA
TAAAACAAAATGTCTGGAGGACCTAAATTTATAAAATTTTACATTTGCAGTATTAGGAGTCGAGCAATCCCGAAGTCGTGGGCGTTTGTAGATGAGTAGA
CTCGTACAAGAGTGAATGATAGATCAATGAGCACAGAAATGACAGGTATCATATCGGTGGGGTGGAAGCCAATGTACCGTTTTGAATCAGCGTAATGGCT
CCGGATCAAAATATATCTTATGTTCAGATGGGTGATCTTGCTTAGATGACACTTCGTCGGAGCTCAAAGCTATATCAAATACACGATCAAGCTGGAGCCA
CACCAGTTTGATTGTGTACTTAGTTTGATGGATCATAACGTTCGATCTGAACAAAATCATACGATCAGATGCGTAGTAGCATGAAGTCATGCTTCTTGCC
TCTTCAGCATTCGATTGTTATTGGAAGTGCTCTACAAGTTGGATAGTTGGATAGTAGATGAGTTAGGATCATCGAACGTTCCATCAAGAATGAGAACGAT
TACGTTCTGACACAAAGATCCGATACGTCTCTGATGAGAGAGCACCGCGCTGAATTCTTCACTCAGCACCCGTGACGATGTAAACTGTCTCACCTAATGA
TCTACTGGTACACTTCTTTTATTACAGGACAAGGCTTTCGTGATCAAGTAAGAGTTAGAAACACCCCTAAGTTTTGATATTATTTGGTTACATTCGTACA
TTGGATGCTCGAGTAAGCAACAAAATTAGCAATGCTCGCTCATCAGAGCAGACTGCAAGCTTCTCCGACAAAATGACACCCGACCAGTATGACGAATATG
TCAACCCCGAAGTGAGTTATTCACGAATCATAATATGTTGAACATTGGAGAAACACAGATCAAGTTAGGTTCGATTACAACTAAATAGATATCGTAATTT
CAAATCATCCAGACCGCAGTCAAGTCTTTGTGAGATCTCAGTCGTAGCCAAACTCATCGATCATACCGATCTGACGATAGTGTCGGCTTCCGGCTTCGTC
GCATACCACTTAGTTGGCAGGGCTCCCCTCGATCGGAGGGATACTGCGCGTACACGCAATAATCGTTCAGGTATAATGCAACCTCCATGCGTGTGTATGT
GTTCAGCACATTTATTGACAACCACTATGACGCGAGTAGCATCTAAAATGCATAAAACGTCCGACCAAAGGAATTAATCTGGGAAGTACAGACCAAGATG
TTGCAATTGGGATTTTACGCGCAATTGATCGAATCATCACGTCGCAAAGGTCTGGTTACCCTTACTCACGTAGCTAAGCCGGTGGATGCCAAAAAGAATT
CGAAACGTGGTATCAAATCTATTCCACCTCAGCTCTGCAGGCCTTAGTGATCGTCGGGATTTTGCATGTATAGTTCGTAGGCTTTCTCTGCTATAGACGA
AAGCTCTGAGATTACTAAATCTCGCACATCCTGTTTGTAAATATGGAATTTCTGCTGTCTGTTATTGGAATTCCGACCAGGACCAATAA