Description :
Non Conding Region
Location :
Scaffold_1:80226- 81762
Sequence
1536 bases(100 bases per row)
TTGACGAAAAGAGATTGTGGTACAGTAGCCGCCTAAAATGGACGAGACAACTGTACCCTTTTTTTAGAACATAGTGCTCTTAAGCTGTAGGTCAATGTTC
TAAAACTGTCGGTCAAAAATATGGTGCCCCAAATTAAGTGAGATTGCAATTGTTTGCTACCGGTAATTAGTCTGTGTGCGGAAATAGTTATGTTCGAAAA
TAGTCTATGTTCGAAAATAGTCGTGGTCAGACTATATATTGTACTGGTCAAAATGTAGAATTCATAATTAGTCTGACCACATCAACTTCAAAATTAGTCT
CTCCTGTGCCATGCGGGTGAGGGTGCAAGGCTCTAATCACCACGACTGGGTTACGGCTCATGGGCTGGGAAGCTACAAAATCCAGCTTGCTACAGAGGCA
GTGAAAGCTGTCAACCTTCAAAAGGACAAAAACGGCATGTCCTATGCGCGCAAGGCGATGATTCGATGTGGACTTTCACTTGGAATCGATGTACCAAAAT
GGTTTATCGCTCATCTTGTTCCAATACCTGACGTAGCCAAGCCATTTTTCGAACTCGGGTTCTTCTTGAGCAAGAAGGATGTTCTTGCAGCGGTGATCAG
CCGGGAATTAAACCCCTTCGCCTTGAAATACTCTTGAGTATCGACCTGTGCCTGGTCGGTTGGCCAGCTCTACCCGCATCTTCAAGATATTATCGCGAAA
CACCGCGAGCACTTCGAAGGTAAGCCGGTCGATGAAAACTCCGAGTAAGACTCTTTTGTGTGTGTTGCTTCATAAATAGTCTTAGCAAAAATATAGTCTA
GGTCAGACTATTTATTGTCTAAGAGCAATGAACCATTCAATCAAAAATAGTCTAGGTCAGACTTATTACCGTAGGCAGTGTAGACCCCAAAAAGGGAGCG
ATCTTTCCGAAAAATTACTTAATTTGGGACACCACATTTTTGACCGACACTTATGGAGATATATTGTGCTTTGCAGATAAAATGTCGCCCCGTTTTATGG
CCTAGATCGAGGAAGGCCGGCCCACAAATCAGGGCACAAAACAAAGGCGGTAGCATGGACGACCTCGATTTACTTCGATCGACCTCGAATTGCGCTTTTG
AAAACGCAAAAGGGATCGATTTACCGTTGATCGACCTCGTTATGCTCAAATCCACCAGGAGATCGACCTCGAGCCCTGATTTGGATTGTCGTAGGTCGAG
TCGCCTCGCCGACAAAGCAGTCGCCCTATCAGTCTTCATTTTTTCTAACCTACTGCCCGGACCTCAAGCCTGGACTCACTGCCGTCTCAGCCCGCGTGCG
CGTCCGGCTGCTGCCCCTCCCCCTGTCGACCACGTAGCTCAGTGAGAGAGCGCTGGGCTTTGCCCTGAGGTTGCTGGTTCGACTCCATCTTCTTTTTGTC
ATCGGGTGGAGGCATTCAGGTCTGTGGGTGTTGTACGGCTGTATGTGTATGTGAGTATGCAAGCGAATGGACATGTAGACATGTATTTTGTTTATATACA
CGGAGTGTCGCTCGAATCTACCTGCCTAGTCGTGCT