Description :
Non Conding Region
Location :
Scaffold_1:80008- 81006
Sequence
998 bases(100 bases per row)
GGGACTACTTACAGACTGGTGGTGACGGCAGACACTGACCGGACTAAAAGTTAACTCCAAAATGAGCAAAAAGTGTGATTTTGGTCGGACAAAAAAACCA
TCTTGGTACAAAACCGATCATGGGGCCCCCAGCATGTACCGAACCTGGCTGTACCCGCCTCGTGCGCTCTCGAGGCCGATGCAAAGCTCACGGCGGAGGC
CGTCGGTGCTCCGTGGAAGGCTGCAACCGCGGCAGTCAGACCCAGGGGCTCTGTATCCGCCACGGCGGAGGCCACCGTTGCACTAGCCCTGGAtgcacga
aggcgtcgcAGTCCAACGGACTGTGCAAAGCTCACGGCGGCGGAGCTCGCTGCCAATATCCGAACTGTACGAAGAGCAGCCAGGGCGGTGGCTATTGTCG
CGCTCATGGGGGCGGTCAGCACTGTAAAGAGGAAGGATGTATCaaaggagctcaacgcgGGGGGCTATGCGCGAGACACGGCGGCACGAGGTTCTGCCAG
CATCCCGGCTGCTCCAAGAACGACCGAGGCGGGGGCTTGTGCGCTAAGCATGGAGGCAAAGTTCGCTGCACTAACGGAGGCTGTAAGAAGCTGGCAAGGA
TGGCTGGTCAGTGCTGGGAGCACTGGGCTGCGGCTAAGGGAGAGCTACCGGACGACCAAGTGGTGGCATCAATAAGTATGAACAGCTCGGGCGAACTCCG
AAATGCGCCGTCAGCGACTACAGAAGAGACGCAAGTTGGGGTCAAGACCTGTGGATCAAAGAGCGAAGatggtgttgctgttgccgctgtTCTTGACTCA
TCAAAGGAAAACGTATCTCGACAACATGTAGGAGGAGAGAGCTCGAATGAGGCGCAGACAAGGGCATCGACAATTGCTGCCTAAGGATGTCACCGTACGT
TGTTGGTTTAATACCATTTCTGGTTTTTCAGTTTCTAACGTTTTTTATGAAGGATACATGTTTGAAACGAGCGGTCCTCAACTACCGAGTGCAATCAA