Description :
Non Conding Region
Location :
scaffold_1:79721- 79920
Sequence
199 bases(100 bases per row)
CGAGATCGAGCGGTTTGAGGAGTCGGCAGGAGGAGGTCAAGATGCAGTTAGAGTAACACGCCCAAGATCTCTCCCGGTCGCGCTGATTCGGGTAATAGGC
AGCATTATAAGCTGCTGATAAACACGCCAAACTCCCATGCATCTCCATCGATGGATGTCTGTCCGTTGATTTTGTCTGTCTTGTCTCTTTTCTCTTCCT