Description :
Non Conding Region
Location :
Scaffold_1:79436- 80457
Sequence
1021 bases(100 bases per row)
GGCACGGCgTGGGTGGCGTCAtCGTTTAGGAGCGcGGCCcGCGGAGACATACTTGAAGCGACAGAGGGCAGAGAGAGAGAGAGAGAGCATGAAGGGAGGA
GCGGAGGAGTGGcTtGATGCTGCACGAGTGATGACTTGTATGATTGTGAATGGATACACTTGACGCAACGTACTGTACTGCATTAGTGGGATTTGCAGAT
CCAGTACCGGTTTTACGTACCGGTTGATATCAGGTTACGTCCCGTCTGCCGACCGCGTCCACTTTCTGTGCTGGCTTGTTCGTTGCGTTGTGCTCTCGAT
CCGGCTGTCGTCACATCTTGTGGGTGTCAGAGCTTCCACTGGAACTTCCAGCACTGAAaCTTTTGCCTGGCCCAGAAAATCTATTGTTGTTGTTGTTTGG
TACCGGCAGCGATTATTGCCATGCCATGAACGGACACCACGGTCGGATTATCCTGGTCGCAAGCGCCGCCACTGTAGCGCACGCCAGTGTAGCAAGGTCT
GTGTCGCATCCGACGGAAAACCCGGCAGCGTCTTCACCCTGTGCGTGATGGTGAGAGACATCCCTCCGACGGCAGATGGTGTCCAACAAAACGAAGTGCG
CGGTGCCTGCGACGTGCAACGCCCGAGGAACGCTTGATCAACTCGAACCGCGTCGAGTGGCAGAGGCACTGGCGCAACCCCGCGAGGCTCAGCCTCGCCT
GCAAGGGAGCTTCGACAGCTCGTCATCTGTCCGCAGTTCAAGTCCTCGCGAGTCTCATGGGTTGAAGGGTCGCCGCGTTGCTGCCAGCTGGATGGTTTCT
GTCGCATCCAGATGGCCGTGGCTCCCCCAACCCcTCCAGCGCGACAACAAGAAGAGCCTTTCCTGGCGGCCACCATGCGGCCTCGAGGCTCGACCTCCTG
ATCTCGACTACCCGCCGACTGTGGACTGTGGCCCGCCAATTATCCGGAGTTGAGCTCTCCGCCATAACGCGAAGTGCCTCCTCGACCGCACTCGACTCCT
CCCCcGCTTCCTCCTCCATCA