Description :
Non Conding Region
Location :
contig_1:79430- 82477
Sequence
3047 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAA
ATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTC
GTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGG
TAAATAAAACTATCTCGGCACTCTTTCACTGGACTTTCATCGGATGAGTACAAGTTATCGATCCCACTTCCCCATTCATGATGGCGAGCCTCTCTTCTTC
CTTCTTTTGCCGCCGATCCACGTTGTCGTACTTGGAATAGTCTATGCGAATCGTTCGTTGGCGACGCACTAGAGTATGGAAGTAACCTTCTAACGCGATA
CCCTCTCAGTATGGCAACAGACAGAGCCTCACAGATAAGGCAGCCTCATTCGTCACTTCAAAGCGCCTTGGGGTTGCCAAGAGTCTGAAGCTATTGAACC
ACATCAATTCTTGAGTTCACGCCGATTCAAACCGTCGATGCAGGGCCAGAAGACACCCTTGTTGTCAATCCACTCGTAGTACTCGCCTTCGTAGAATAAG
CGCGTGACTGGTTCGCTAAGCTCACCGTCAAACTTACGGAACCACACGACTCTTGCCTGTCTCTAGACTCCAGCTGGTCCTCCAACTTGCCACAGTCGAT
CTTCTCTTTGAAACGTTTGATATTCTCCAGCACGTAGAACTTGGGACCAGTGAAGCTCACGATGTCATTGATCGCTTGGATGTCCTTCACTTGGCCACAA
TCCCCATCTGTCCATTCAAACATGTGCAGGAAATCTCCTTCCTCTGGCAATATGCCACGATTCACACAATGTTTTAACAGGCCTGCAAGGCTTCAGTTTG
GTTCTGGGGTCGCTTCGGTGGCAGCAGCTCTCGGTCATTTTGTGGTCGTTGAAACCTCCACCAGCACGTGAATCTGCTCCGACTCGGGGCGCAGCAAGCT
TCTTTTTCAGCATCAAAGTCTCCATCGTACGACTTACCTTCAACGGCTTTTCCTGGAGTAAAGCCTCGATATCGTGGTGTGTGTTTTCCCGTTCCAGTTC
CGTTGTGGCTTTATCGTCATCCGGTAGCTACTTGGCGCCTTTCGTGGCGAACCACAACTTCAGTTCATCTGGTTCGCACGTGATTGTTTGGGGCTTCTTC
CTCATATTGAAGAGACCCACCAAATCTGTCAGCTTGCTTTCACGATGAAAGGGCTGCCCTTATTTTCCAGCTGCGAGCAGACAACGCTTCTTTCTTGTCT
TCTCTTTCACTCCCAACACCGTTTGGAACTGAGCACAACAATATTTCTATCACTTTGCCCCAGTCACTTCGGATGCCCAAGTTAGCCGAAGTCTCCAAAT
AGGGTGACCAGCTTGGTCATTCATGACCTTCTCCATCATTTTCCCACCTCGTTCTCAGTGACAATGGCATCTACGTTCGCTATGAGTCCGATCCAGCACC
CACGGGCCAGATTCTCGGGAACGGGGCCCATTGATCCACTCGCTATCGGTGCAGCCCGGAGACGACGAAAAGAGACTGTGAACGAGCGGTGGAGCATATT
CTGAGAGGGGCGTTGCAAGACGCTGAGGAAGAAGCGCTGCAAGACCGAGAAGGAGGTCCTGAAACACGTGGGCGAGCATTGCAGCGGTCCCGTCAATTGG
CCTCTCTGTACACAACGTCGACGGATAGCAAGTTCCTTCGCTCTCGAGCAAAACGAGATGCCTCCATTCAGCGGTGCAACGAGGTGAAGGCTCAACGAGA
CTCCGAGTCGTCTGTACGACGTGCCAGGTCAAGAGTGGGGTCAGATTATACACCAAGTGTGATCGGAGAGGGTAACGAGAGCGAAGAAAGTGACGACGAC
TCAGTATCGCAGTGTCGGTTAGAGCTGGCATCGCCCATCAAGCAGGGTGTGAGCTGGGGTGGAGCGTCTTCTCCATCCCCAGTCTCTCCAATCTCAATGG
TAAAGCCAGCAAAACCATGGTACGGCTGTACTGCAGCAACGTTGAAGGAGCAGGTACCCCTGGGCGTCACACTTGACGCTAAACTGCGTCGATATGGAGC
CCGAGGTACAGCGAAGCTTTTGCACGGGTGGCGATCTCAAGAAGCGTTGGGACCGCTATCTCCCATTCCGCTGGTTGCATCTGTCGATACATTTGTGTCA
GGGTTGAGCGGCTCACCTTCGTTATGGCCACCTGAAGCCTTCCACCCGACCGGGTCCAACCTACGCGTTACGATGACTCGTTGTCCTTCGTCTCCAATCG
CAGTCTCTGTGGAAGTTCCTACCTCCGTTGATGATCAGAGCTCCAATCGAGTGGACTGTCAAACGCACACGGAGACGCAAAAAGGTTTACAGCAAAAGGC
AAGACAAAAGCTTCGAAGCACCTACAACCGAGAAGTGCAGGTCGAACGGGAGGAACGCTTGGAAAACCAGCGAGATCTCGCTCAGTGGCAAAGCCGCACT
CTTCATTTTGTCCCATCCTCTGAGCTCGCTGCGCATCGAGAACAGCAAAAAGGGGACCCGCATCTTCGCCATCGACGTACCCAAGCCTCGGCCATAGTGC
AGACACCAGGGTATTCACCTGAGAAGCAGCGCAGCAAAGAGTCCAGAGACTTGAAGGGCAAGCGGTTCAAGCTGCGTTGGCGCTCATTTTCAAAGTTGCT
TGACGTAATGCGACGAACGCCTTGTCGAAGGCCTGTGCTACAAGATA