Description :
Non Conding Region
Location :
contig_1:79386- 83770
Sequence
4384 bases(100 bases per row)
GTTGCGTCGGTAGGTTTGGTACTCAACTTGCTTGGTCGGAGGCAAATCGCGTTGTGAAGGCAGCAAGGTTCATCTCAAAGTGGCGTGACTTGATCCGAGA
TTTCCAAGTTCTCGCTGACGTAGCGCTGCACTTCAATCTATCACCACGATTGAAGCGTGGCTGTGTTTTCCCAGCAAGTTATGTTTGTTTCTGTGGTTGG
TCATTGGTATCTGCATCACGAGTTTGCATGCAGAAGAGAGACTTCTGTCGTTTTGAGCCGTAGCATCCCTGGTCGTGTTAAAATTGAAATAAATGATGAA
ATTGCTCAAATCGATCGAGCAGAGTCAAAACTATGGACTCAGCTGAGGCTTGTGATGTCGCTGGTAGAAAACACTTTTGAGTCCCAGGGTGCACAAGGTC
GTACCGTGAAGGAAAAAACGTTTTAAGAGAATCGATCCAGCAACACAACCCTGAAAGGTTCGCCACCCCGTTCTTGCCGGCGATAGTCGTCCACCATTGG
TAAATAAAACTATCTCGGCACTCTTTCACTGGACTTTCATCGGATGAGTACAAGTTATCGATCCCACTTCCCCATTCATGATGGCGAGCCTCTCTTCTTC
CTTCTTTTGCCGCCGATCCACGTTGTCGTACTTGGAATAGTCTATGCGAATCGTTCGTTGGCGACGCACTAGAGTATGGAAGTAACCTTCTAACGCGATA
CCCTCTCAGTATGGCAACAGACAGAGCCTCACAGATAAGGCAGCCTCATTCGTCACTTCAAAGCGCCTTGGGGTTGCCAAGAGTCTGAAGCTATTGAACC
ACATCAATTCTTGAGTTCACGCCGATTCAAACCGTCGATGCAGGGCCAGAAGACACCCTTGTTGTCAATCCACTCGTAGTACTCGCCTTCGTAGAATAAG
CGCGTGACTGGTTCGCTAAGCTCACCGTCAAACTTACGGAACCACACGACTCTTGCCTGTCCCTAGACTCCAGCTGGTCCTCCAACTTGCCACAGTCGAT
CTTCTCTTTGAAACGTTTGATATTCTCCAGCACGTAGAACTTGGGACCAGTGAAGCTCACGATGTCATTGATCGCTTGGATGTCCTTCACTTGGCCACAA
TCCCCATCTGTCCATTCAAACATGTGCAGGAAATCTCCTTCCTCTGGCAATATGCCACGATTCACACAATGTTTTAACAGGCCTGCAAGGCTTCAGTTTG
GTTCTGGGGTCGCGTCGGTGGCAGCAGCTCTCGGTCATTTTGTGGTCGTTGAAACCTCCACCAGCACGTGAATCTGCTCCGACTCGGGGCGCAGCAAGCT
TCTTTTTCAGCATCAAAGTCTCCATCGTACGACTTACCTTCAACGGCTTTTCCTGGAGTAAAGCCTCGATATCGTGGTGTGTGTTTTCCCGTTCCAGTTC
CGTTGTGGCTTTATCGTCATCCGGTAGCTACTTGGCGCCTTTCGTGGCGAACCACAACTTCAGTTCATCTGGTTCGCACGTGATTGTTTGGGGCTTCTTC
CTCATATTGAAGAGACCCACCAAATCTGTCAGCTTGCTTTCACGATGAAAGGGCTGCCCTTATTTTCCAGCTGCGAGCAGACAACGCTTCTTTCTTGTCT
TCTCTTTCACTCCCAACACCGTTTGGAACTGAGCACAACAATATTTCTATCACTTTGCCCCAGTCACTTCGGATGCCCAAGTTAGCCGAAGTCTCCAAAT
AGGGTGACCAGCTTGGTCATTCATGACCTTCTCCATCATTTTCCCACCTCGTTCTCAGTGACAATGGCATCTACGTTCGCTATGAGTCCGATCCAGCACC
CACGGGCCAGATTCTCGGGAACGGGGCCCATTGATCCACTCGCTATCGGTGCAGCCCGGAGACGACGAAAAGAGACTGTGAACGAGCGGTGGAGCATATT
CTGAGAGGGGCGTTGCAAGACGCTGAGGAAGAAGCGCTGCAAGACCGAGAAGGAGGTCCTGAAACACGTGGGCGAGCATTGCAGCGGTCCCGTCAATTGG
CCTCTCTGTACACAACGTCGACGGATAGCAAGTTCCTTCGCTCTCGATCAAAACGAGATGCCTCCATTCAGCGGTGCAACGAGGTGAAGGCTCAACGAGA
CTCCGAGTCGTCTGTACGACGTGCCAGGTCAAGAGTGGGGTCAGATTATACACCAAGTGTGATCGGAGAGGGTAACGAGAGCGAAGAAAGTGACGACGAC
TCAGTATCGCAGTGTCGGTTAGAGCTGGCATCGCCCATCAAGCAGGGTGTGAGCTGGGGTGGAGCGTCTTCTCCATCCCCAGTCTCTCCAATCTCAATGG
TAAAGCCAGCAAAACCATGGTACGGCTGTACTGCAGCAACGTTGAAGGAGCAGGTACCCCTGGGCGTCACACTTGACGCTAAACTGCGTCGATATGGAGC
CCGAGGTACAGCGAAGCTTTTGCACGGGTGGCGATCTCAAGAAGCGTTGGGACCGCTATCTCCCATTCCGCTGGTTGCATCTGTCGATACATTTGTGTCA
GGGTTGAGCGGCTCACCTTCGTTATGGCCACCTGAAGCCTTCCACCCGACCGGGTCCAACCTACGCGTTACGATGACTCGTTGTCCTTCGTCTCCAATCG
CAGTCTCTGTGGAAGTTCCTACCTCCGTTGATGATCAGAGCTCCAATCGAGTGGACTGTCAAACGCACACGGAGACGCAAAAAGGTTTACAGCAAAAGGC
AAGACAAAAGCTTCGAAGCACCTACAACCGAGAAGTGCAGGTCGAACGGGAGGAACGCTTGGAAAACCAGCGAGATCTCGCTCAGTGGCAAAGCCGCACT
CTTCATTTTGTCCCATCCTCTGAGCTCGCTGCGCATCGAGAACAGCAAAAAGGGGACCCGCATCTTCGCCATCGACGTACCCAAGCCTCGGCCATAGTGC
AGACACCAGGGTATTCACCTGAGAAGCAGCGCAGCAAAGAGTCCAGAGACTTGAAGGGCAAGCGGTTCAAGCTGCGTTGGCGCTCATTTTCAAAGTTGCT
TGACGTAATGCGACGAACGCCTTGTCGAAGGCCTGTGCTACAAGATATGGAGAAATTATTCGCCTTGTCCAGGGAGCTGTGCGCGCTCAATGCGCTCGGA
ACGTGCATGCTCTCGCGAGCTCAATTCATGCTGCTCATCACGAGGGAGTTCCCTTTGTGTGATGCCAAGCACGTGAATCGCTTGTATTCGTCGTACGACT
GGCAAATCTGTGACTCAGTAGATGCTCGATTCGTTCTTGGGACGATGAGAGCAATGCGTGTGCAACAAGGTGAGCCGATAGAGCTCATCTGCAACACGCT
CCGTGATTTTGACGACACCACCGCCGCCAACACAAAACTTTCAGATGACAAAGCTGTGGTCTCGAACGGTGTTTGTTTAGCGAAGGCTCTGTCGCTTTGT
TGTACCAGTGATGAGGAAGAGCGCGAAATGGAGAGCAGAGCCGACCTCATTTGGACCAAACACTTGCCTGGCAACGACAAATTCTGTCGCGACGTCTGCG
CGGCGGTGTCCGACTCAATGTTTGGAAAGCATCAGGGATGTCGCTTTCGCGGGTCTCAAGCTCTGATAATTGCAGCCAAGATGCCGGCGTAGCGAGCAAA
GTAAGAGACTGTGAGACCAAGGAAGACGATGGCGAGGAGGACGTAGAGGACAGCAAGGAGAACTTCCTGAGCTCAGCCAACTAGTAGATGAATCTCGCGT
ACCTGTGCGGCGTATCCGTGAGGCTCTCAAGCGAGAGCGAGAGACGCTGACAATCTTCACTCAACAACTTCTCCAACGCAGGCACGAGTGTCTTGTTGGT
GCCAGCACGAGTTCTCCGAGGCAGTAATCTCACGTGTTTTGGTTTCACGAATCAACATCCTTTGCATCTTTTTATTCACGTCTCGACGATTGATCTTTGC
AAAGAGAAGGAGGCTATGATCGATAACTGCGTTGATTATTAGCATGACGACATTGTCCGTGCAGTTTTCATGCGCATTTATCACTTAGATTTACCTGCCG
ACGTCCTGAGCCTCGAACACGAAATACGGCGCCGACACCATAATCTGCATGCGTAGTACGGAGTTGCCGAGTGTGCGAGGCGAACACAACCGGTGTCTAC
ATTGAACACACCTGCGAAATCTCCCAACGTAGGAGAAAGCAGCACACAACCATGCTCGTTGCCGCAACATAGCAACTTCAATCACTTCGAGCGCAACATA
AGTTACAGCAAACACTAGCTGTTACGGTTCCTAATGGCACTAATCACAAAGAGTGACGACACGTCAAGAAAAAATCTGCTTGAAACTGGCAGGAAGCGTG
CGGGTGGTCGCCATTTCAAGGTCAAAGTCTCACTTGGCGTCGGCAAGACTTACCGAACGAGAAGTTCCATATCCACACACAAGA