Description :
Non Conding Region
Location :
contig_1:79345- 79544
Sequence
199 bases(100 bases per row)
CGAGATCGAGCGGTTTGAGGAGTCGGCAGGAGGAGGTCAAGATGCAGTTAGAGTAACACGCCCAAGATCTCTCCCGGTCGCGCTGATTCGGGTAATAGGC
AGCATTATAAGCTGCTGATAAACACGCCAAACTCCCATGCATCTCCATCGATGGATGTCTGTCCGTTGATTTTGTCTGTCTTGTCTCTTTTCTCTTCCT