Description :
Non Conding Region
Location :
Scaffold_1:79193- 79607
Sequence
414 bases(100 bases per row)
GCTGGCTTTGGTGCACTTGTGAAGCGAGCAGAGGTTGAGGGTCCTTGGATCGGTCCATCGTCAGTCTGGTCGTTGGTCGCTTTCACCAACAACCGTTGCG
GCAGGAGCAGGCTGCCGACTGGACCTGCAGAAGGTACTAGTATTGGACTTGGTCGTGCTCGCAATTTACAGCGCTGTCGACCCTGTCGGCTCAGCGTTTG
GACGGCTACGCACTCGGGAAACGCTAGCAAGAAGTGAAAGGTATCGAGACCCCATCCACCGACACCAAGTTTATTCATCAACAATCACGTGGGAGATGAA
TGGATTCAGGAGCAACATGTGATTCCTTGGCACCGCAATAGCTACGGCAATCCTGTGCAATCCTGTATCAACCTTGCCAATATGACCCTGCAGACTGCAC
TTTGCAATTGAATA