Description :
Non Conding Region
Location :
Scaffold_1:78985- 79454
Sequence
469 bases(100 bases per row)
CTGTCTGATGCAGGTTGCTGTTGCTGATTTACTGTAGCTGCTCGCTTGCGAGGAAGAACGGTACTGCGGAGCGAGAAGTACCGTGCGCGGCTCCAGCGAG
TTCTCGTTTAATGGCCCCCCGTCGTGTGGAAAAACCTCGACAGTTCATAAATAACCTCCTTTTTCAACACAAAAAGCGCGGGAAACGAGTGAGTTTTTGA
TATCATTAACTAGTTGTTAACAATAGATGCCACACAGCGGGACTACTACGTCCACACGAGGTTGCTATGCATGATGCATGCCTGGTGCAACCGCATGACC
GCTTGCGATTCGGTTCAGGTCGGGAACCTATCCGTTGCGCATTGTATTCGCTCCTCGCCAGGTTGACGACTGCAGGCATGATGAGGTCCCAGGTGCTGCA
AGGAAATGCGTTGTTGTGAACGTGCAACCAACCAGGATCGACTTCTTGCCGCAGACGCTTGGGCGCAGA