Description :
Non Conding Region
Location :
scaffold_1:78951- 79410
Sequence
459 bases(100 bases per row)
CCATTGCACTTTGGGTTTCGTGCAAAACTGGTGTGGAATTAAATGAAAATCTTTTCCCATGCGAAGACTTCGTTGCAGTAAAGTCTGATGTGAAAAAGCA
TCAAAGCTTCATTTAATACTTTTAAGAGGTGGGAGGGAGGTCTATAGCGGTTGTGATTCTTCAAGTACTTCAGGTTGATAGCGTTTTTCTTGTGACCCAC
GTATCAGAAAGCTTTTCTTCAGAAGTACTTCTAATGAATACGACCGAAGAGGAAATGCCTTCACAATGATCCTCACACAATATTCATAGCTTTATGACAC
TACCAAATCCAAGTTGACTTCAATATTCAGGTACATGTGCAGCTGTTGCGCGCCGTTGTTGGTATTCGAATCAAAACTTTGATCTCCGAATACTTGCTGT
GGCTCCCACATGAGTTGTTACCTTGGCAGCGCACGTGTCCAATCCTACGCTCAATCGCT