Description :
Non Conding Region
Location :
Scaffold_1:78759- 79252
Sequence
493 bases(100 bases per row)
AGTGCTCGGTCCTGCGATGAAATGGTCGACTTCTTCAGTGGCACGGGATTTTTCGTTCGTTTCCGTTGAATCTGCACAGGAGGTCGGCGGGAAAACGTCG
GACTCGGCTCAGGCGACGGCGAGGGTGCTGGCTTAATGGATACCGGGATTGCTCTACCCAAATCCTTGCTGTTACCAAGATGGCTCGCCCTCGTTGGATT
GGGGCACGAAGCCCTCTCCATTCTTCCAACACTAGTCTTGACAGATCGTTTCGGGATTACAAAATCGGCACTTGGTGGAGCTTTTAGCTTTTTCGACGGT
GACTTCCTCGGAATTGGCATCATATCCAACAGCATACTGTGCTTCGTTGTCTCGTCGACCTTGCTTTTGTCATCAACGTCTCTGCTGTCCGAAATCGTGT
TCTGACTTTCGCCTTTTTTCCCTTTAAGATCACCAGCGCAAGAACGTGACAGCGGAGGCAGGCTTGATTCAGGCTTGTCTCCTTCTGCCCCAT