Description :
Non Conding Region
Location :
Scaffold_1:78579- 81617
Sequence
3038 bases(100 bases per row)
AGGACAGCGCCGTGTCGGCAAAGATGCCATTATCTAAAGACAAACACGAGTGACGCTTCTCAATTCGATATGAATTGGAGCAAAATGGACAAAGTGCGGG
CGATCGTGCAGGTTGAACTAAAGCATTAACCAAATGGCATAGTTGGCTTTGTCCGGCTCACTCTGTGTACTCCTTGCCCTGCTTGTATCGGTCTGTCCAT
TTTATGCTGTATGTATTAACTGTCAACGGCAGTAAAGTAGATACAATCTAAATGGCTGCTAAAACGCTTGGAGGCTGCTATTATTACCTGTAGAAAACAT
AGTCCTGTCCTGTATTCAATCTGCGAGCAGATACAATAGTGTGTATTTGAGCTGCAGGAAAGGGTGCAAGCACTACTGGCCATGGTCTACATCGTATTAG
CCCATTGCTACCGTTTACTACTGTCGTTTAATCGTGGAAGAGCTATCCCTCTGGTTGCTGAGCACTTTTCCACACACCACAATTACTCTCTCATAGTCAA
TAAGTTCGTAAATTTCTCATAGAAATTTGCATTTGCATGATAGCACCTCCGTTATAGCCCATGTACTTCGAGTAGATACCCAGCGGGCGCTTGCAGTCAG
GAATTGCCATCAAAACACACAAAACAATGTCCTTGACGGACGCTTTAGCGCTTCTTGCAGGTGATACCTGCTGTTTCTAAAGTTTCATGAGCATGATGAA
GCATCCCAAGGTTGCTCGGAGGTACATAGCATAAACCACTTGGTAGCACCGTAAAAAGGGAGGGATTGTGCACGTTACGCGCGAAAAACCATTCCCTGGA
CATGTAAGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCATTCCCTGGACATGTA
AGGACCAGCATTAAAATATGAAAAAAACGACATAATGTACTATACTTTACCAAAGTCTTTTGAACCTGTTGCAAACGTGAATGGAATCACACTGCAAAAC
ACGCACAACCTTTATATTTTCAAGCTTTCATTGGAGGTTATATTCAAGTTTATACGGTCTGTCGTCTCGTGAGATGTAGTTAAGATCAGTGTATGGGAGT
ACTGGCATTGTATCCCTAGAGCGTCTTTACATAAGTTCGATCTCGTTTCGTGTCACATCCTGGTCCAACTGCTTCTCGTCTCTGTGCTCAGATTGCCCTT
GCAAGAGACAACGGTCGTTGATCCTATGCATTCGATGCGCGTGCACACGTATTAGCTATGCTTCGGACCAATAGTCCAGTCGTCCTTACATAACTTCAGG
AGCTGGTTACTACTTTCTAGTGTACTTGATTCTACGATCACTCGTGCCGACTAAGTCCCTTCACAGCTCGATTAAGGTTTCCGATGAGCGCGCTACAGAG
CGACGTAAATGTATGCAAACGCAAGTGGCCCCGTATTTGCGTGCAGATACATAACCTCCCCATGTTATGTCTTCCAAATTGGACATTCCGATGACACCTC
TTTTTTTCCTATAGCATGCGCTCCCGAGCATCAAAAATTGTGTGGATCTTCTTCGCCGAAATACGATCTCAAGTCCCGAGACGGGCATCATTTCAACAGT
CATTTGTGCAGCGAGCTGTACGTATGATCCACTCCAATTCCCGCATCGATCACAGCCTTTGTGTCGTCAATGTAGACAAATAAAACATGCATGATCAGCG
TGTTTACCCTCGAAAGGTTAGAACGGATAGAACAGTTAAAGTCAATTTGTATCTATTGCTTGCGTAGCTGGTATGGCACCCCCGTATTCCTCATTATGCG
ATTCGAAGGAAGTAATGTGTCCAGCGTCGTGTTGGCGACAGAGCGCGAGCACTTACTTCGTGTATGGCAAGCTTATTGTAACATAACTTAATAGGCTGAC
GCCCTGGCTATAACAAATGTCTCACTAAAATCAACAATAAGTCTTCACTTCGGGATTCGACTCCAAGATGTATGCTTGCCCCAACCAGTCATATGGTATG
ATGTCACGTCTGACCAGCATATATCTCACTGTCTACGATCTACGTACTTCTTTGTCACTCCGGTGCAAAAGTGACCTACGAACGACATGAGTGCAATCCA
TCACTTACATTGCTCCTATCCGAATAAATTCGTAATGTTGCGGTGAATTACGAATTTATTCAGTAGCCTAGGTAGTATAGCGCTCACATCTCTTCATCAT
GATGCAAACGAACATTTTCAGTGCTCTAGTTGATCCTTCTTTGCTTCCGGCTTAGCACCATCTTGCTCAACTCTTTTAACACTAGGCCACAAAATAAAGA
TCCTTTCAGACGGGATCGATAGAAATGCATTCGGTCGCAGTAGCTCGATTGTACTGTTACATTATGACGTTCCAGATATTGGCCTAGAGAACATAAATGT
AGAAACTCAATTCGAGATTAGAAGAATTGTTGTGATACTTTTTTCCTCTTGCAACATACTTTCGACGTTAAAACGATCAAATGTAGCGACATATGTAGTT
ACTCGTTGCAACGCTGTTATGTATCATTTCGAGACTATTAACGCTTCAGTATAGCGAACATGCGTTTATTAAACCTTGTACAATCCGCATATGGCTAACC
TTCAGCCTTAGCCATTTCTAGTGTCTAGGTGAGCTATATGGTTGTGGCATCTTGCTGCGAAGCGCGGCCCACGTTAGATTACATAGGTCTGATCTTTCGT
CGACGAATTTCCCACGCATACTGCTCTAACCCCTAGCC