Description :
Non Conding Region
Location :
Scaffold_1:78521- 79505
Sequence
984 bases(100 bases per row)
ctcttagtatcagacgcagcatttccatcgctcttgcgttgactcgccgctagctggctagcactagccacagtgccagcctcgaagtgatactcggatc
catacacttcgaacggcaagtgcacagacaccggtttacttccggtaacggcacattgagcagtaatagagaccatgtagaagaccctagctgaggatcc
gcggaatgtggggcagatattctccggaagagcaatggcgaattctcgcgtgcagcgctccgccgtctcttcacgtgcagcttccgcggccgacacagga
tcaatacctccgtgactcttcttcgcagcagcatcaagctcggactgtgtgggggctatgttgatatcggagagcagcaccgacggagctgaacggaaga
tgcacgtgcctgtatctcccgagaaggtgcgtacgtccggtaaagctgcttccattttgtcaaatagcacgacatcttcggacagtttgcgctccagctg
tgcgcgttccttctgcgacgccgtccggggtgaaatcacatgcactacaggcagagtgagcaggttgctgtccaccgtgacgtgtccgtgtacttgagcc
acgacgtgtgcgatctctgactgcgcgttaggcttctgctgcttactcaccagcctcacaacgcctttgacgacgcctccgggtcggaagtggcgactcg
cgagccgcgcaacgagctcgctgccttcgccctgcatgacgtggtcgatcgaagtgcgtaagtgcggaaactatgcgcgaacttagtggtgtgaccacat
taaatagatggatggctacacataagttgaagtgaccagtacccgctcgtcctcattgagcgtcgcatctcgtcggactctcccactaataaaacggcta
atgcgaagcaagcctgtcgcggattaggcggatcccatcatctgaggcaccgccacctctagctgcctgcggggtggccttcta