Description :
Non Conding Region
Location :
Scaffold_1:78432- 80292
Sequence
1860 bases(100 bases per row)
ATTTCAGCGTCGTTGAGGATCGTGCTCAAGCGGCTTGAACCAAGCCAAAGTCGATGAGCTTTGCCCTCTTGTCAATACCGACTAGCCCGTTGTCGCACTT
GAGGTTGCTGGCACGACGCTTATTCCATGCATGCACGCGAGCCCCAGCGCGACTTCGTATACACAAAATATAGCGCTGGTCGATGTGACAGGCGCTGTAT
ATAATTCCACAATGTGAGGGTGCTTCTTCAGCCGATACCATGTTCGTACTTCGTGAAGGAACAACTCGTTCGGAGTTGCATCACGCGCGTGTTCGTCCCC
CATAAGCTTGATCACGACCGGCGTATCCAACCAGACTCCTTGGAACACTTTTTTCCAAACGCTTCTTGCTTTCTCACGATCCTCCTTAAGGTGCAAGCTC
GCTCTCTTGATAAATCGATTCCTTGGACACTCTAGTACGCAAGTACCTCTTCAGATCGCAGAGCGTAGCATAGAACCTGTCAATAACAATGTCCGTCGCT
TGCTTTTCTTGAGACACGAGCTGTTGGAAAATGAAGTCTAATGCTGGACACGCATCAGTGATGAGCCACCCGGACTCTGGCAACCGAAGGCAGCGTTCCC
GAATGTGTTGTAGCTTGGCTGGGAGAGTGAACAGTCCAAGATCTGGAGACTGGAATGTCTCGATGCGTCCAGACTGAATAAGCTGGCATCAAACAAATCA
ATACAAGAAAGAGGTTTACATGGCAGACGAAAGAGACTTAAGTTGTCCAGGAAACAGTTTGGGCGATGCGTTGATGGAGATACTGAATGCCAAGTGCGAC
CTCGGACAGGTACTTCCTGCAGACTTGTTGGTTGTGTTCATGTAGTAGCACATCGAGTAGTCGTGTTCCATAGTCATAGATGAAGAAGGGCACAGACTCG
ATGTGGCATACACCGAAGAGCTTCTGCACGTTTGGGTGGCTAAGTGGGCACCATCGCGCTGGCTGCAGCCAGGCTGAAAGTCGTCCATTTCCAATTCAGA
CGCACCGACTATCACTTTGGTCTTTAGCCATTTCCCTTTCATACTGTATGGTATCGGCACCACCCGTGGAAGCAGTTGGCTCTTCCATCTTGGACGGCTT
GCGCTATCTCTTTGCTCTGAGCTCTTTGTTGTTCTTGCAGCTCATATACTAACAATACAACTGCACGGTCCTCATCGGTGCTGCTGCCCAGCCTATCTAG
TATTGAAGTATCATCGCCTAGCTTCTCATAGATACTCTGCAGCGCAGGTGTTTCTTCGTCAACACATCGATCCCTCCAAGTACAGCATTGCAACAACATG
GTCCAACTCTTCCTAAAAACTCCAGATAGCGCTTGGGATGGCACGAACATCAATGAATGGTAAATGCCCTGTAGCCGCTGCACCACTTGAGTAGTCATCT
CCTCATATTCATGAGTCAACGCGCACTGCTCTCGCATTGTTTCCAATGTCCCAAAAAGCAGTGGAGTTCCACTATTTGACTGGTTGGAAAACGACGCCAT
CTCATCGCACTTCATGATGAGCGATTGAACACCAGGCACGAACTCCCATCGCGATATGGATATCAAAGGTGTTTCTCCATCAGCTGTTCGGACGTCCACA
CGAGCCTCGATCAAAGCACTGAATACGTTCATATGACTAGTCAGTGTGAGGTAAATCTCACATTCGAGGTGCTGTTTGTTCCAAACCATCGTTCCATTGG
CCGATGCTCCAGCATTCAATAAGCACATGACCGTGTCATTGTATCCGTGCTCCGCAGCATAGGACAGTGATGTTCTTCTGTCTCAGTCCTTGTCGTCGAC
AACAGATACGTGATCTAACAAACGCAACCGAGCTCTGTGTGACCACATCATATGATAAAC