Description :
Non Conding Region
Location :
Scaffold_1:78417- 78992
Sequence
575 bases(100 bases per row)
AACCCGTACTAGGAATACTAGTGTCAGGGTGGAGGCAAAGTGCGCAAGGAAGAACTACAACTAGCATAGATAGTTTATACTACTGGCGGCATTCACACCA
TTCACATGCAATGTTCGATCACGTATGTACGACCCAGTTCTTGAGGAGTTTGACGAATGGGGAGCAATCGCCGTCCTCTACACACAAGAGTCCCTGAGAG
ATTCTCTAGCGCCCGTGAGGGTGGCACGTCATGCCTTGGCTCGGCAATGCTTTAGAGCACTTCTCAGCGCCCAAAGCAGAGACGACCCTTGCATGCGTGC
CCAAATAATACCCACAGCGCAATATACTAAAGACACATCTAGGTATTGAATGTAATAACGTGCTTACAGCAGGTCGAACTACTGCACTGTGTAGCTTGAT
CGATTTCGAATTGAATTGACACGCACCAAACCGGCTCCTGTCCTCCATCCAATTTTATTCTGAATATTACCCAATGATCACCTCGTAAAATACCTTAATT
AGCCAATCATCAAGGTGTATCTTTGAAACGATCATTTGTGACAGATGGCTATATGTATCCATGTTGGAGCACACT