Description :
Non Conding Region
Location :
Scaffold_1:7813- 8407
Sequence
594 bases(100 bases per row)
GCTGAGTGAGTTAGTTGATTGAAGCTGTTGCGGGGGACTGAGCCAAAGGATGAATGACGAGCGTTGTCAGCCGCGCACCGCGACGCAGTACCGTAAAAGG
TCGTGAGAGTCCCTCGGAGCTGTGCCCAACCAGTCgtgtcgtcgatggagctgctgtgtgGACGTTGGCTTTTCTCACCCAGGGCTCACCAAAGCCAGGC
AGGCTGAAGGCGGTGCTTCAAGTCTTCGAGGCCTTGCTTGCTTTGCTTCGAGTCGCAGCGCAATATCCCCCACCGTCCTGGGTCAGATTTTTGGTGCGAA
ACCGCTAGGCGAAGGTGTCTACATCATGATCTTCAACGATTGGCATCGCGGCACGAGGACGTGATGACACCTTTTGCAGTTACAGCAAGCGCCTTCGCCG
AAGCAGGCCAGAACACCTCAACGCACTGCATCTGCTAATGCGTGCGCTCATTTATCTTGATGAGCACGCTCCGAGTCGGTCAGGAACCTGTCATGTATGC
AGTGGCAAAGAGGTGTCGTCAATCAGGCCAAACGTTGTCCTCGAGGACGCGTCATGTTGAGGGGCTCATCTGCGCCATTAAGTCGGCGCCACTC