Description :
Non Conding Region
Location :
Scaffold_1:77973- 78791
Sequence
818 bases(100 bases per row)
TGGAACTGATTCACGACCTCAGTAGTATTTGCATACGTAGCCGAATGTGGGCAGCGTGGGCGAGTTGGTTCATTACTTAATTGCGATCAATGAATCGAAT
GCGGCTGCTCTCGTCGGCTGTCGCGCACTCCCCAAAGATACTTTCTGGAGTCGTAGGAGCGCTTCCACAGGGGCCTTTGTTAATCTAACACGCGGGAAAT
GCGAGCTGTGCTGATGGTCCAACTCGCCCCTATCGACACACGCACAGCGCACCTTCCGCGGACCTTGTCGCCCCCTTTTCTTGAGGCTTGCGTCACTTTC
TACTTCTCCCGCGTCACACGTCAGTGCTCCAGATTGACTGACCTTTGATGATACAATCCTTAAGTTTACAAGTGAAGTGCATGTCTACAAATGAGGAACC
AGCACTCACTATGTCAACAAAAAGGGGCAAAGTTCGTAAAGTCATCAATGTAGAGCGCTCTAGATAAAGGCATTCTGGAGCGATCCACAATGGATCTCGA
CTTCCCGCCTGCTTCCTCACCACAGATCGCCCAAATGAATAGAGCCCCAAAGCGGTAAGTAAAGAAAAGCGAGCTTGCCTCAATAGCGTAACTTACGTCC
GTAGTATACATTCAGGAGTGCATTCATTATTTGAGCAGTCAAAAATTTTCACGAAAAGTTTTTTGCCAGAAGGTAAACTACCGTTAGTTAACGTGGATCC
GCGTCGCCTTGTTGGTTTGTGTGGGGAAAAAAGCTCGCTTTCTCCAATCCAAAGCTGCGCCCGAACGCCACACGAACGAAGCACGCAGGCGCGTCTCCCT
CTCTATCCACACACAGCA