Description :
Non Conding Region
Location :
Scaffold_1:77967- 79308
Sequence
1341 bases(100 bases per row)
GATGACGACAGATTATGGGAGTGGAGGCACGCTCGAGCATGTTGAAGAGGTGTAGTAGGCGAGATTATATTGGAGTCGAGATTGTCGTAAGCGGAGTGCG
TGTCGGACTAGCTGTTCACAAACGAAATGGACTGCTGTCGTACGACTTATTTATCCTGAGAGTGAGGCTAATCGGTTCGCTCTGTCCTACAGATGAATAG
GCAATTGACTTTGAGAAGGTAGGAGTCTCCTCGGCGGTGGTTGACTAATGCGGCAAGCGTCTCGACCACGATTTTGGTGTCGACAGTCACACCGAGGCGA
GGCAAGCACAATCTATTGCATGGCACGTCCTCGGCAGTATCTCAGACGAACGAAGGCGAGTCGGGTGATGCTGAGAGAGGATGGCGACGAGAGCGCCACA
ATTGTCGTAGACCACCGATCCGGTTGAGCTACAGCTCCGCCGGTGGCTGGTGATAGTCCTATGGAAGCGGAGTATTCGAGACAACTGCAGTCATTTCCTA
CAAAAGCTGAGCGACATGCTTACATGCATTGAATACTTCGCGTGCCTACATCCTAGGACCAAAGGAGCGAGGTTGTACTCGCTCCTGCCTGTCGCGACCA
CATTTGCTGCTGATTTCGTGAAGATCAATGGGCCTGATGCTTGATGTTTGATGCTTGATGCCGGCGAGTTACTCGATCAGGTGTTGGTGCTGGGGAGCCA
ATCGTGCTCGATGCGCATGTCGTAAGTCAGACACTTCGATCAGAGGCACAAAGGCATACTGAAGTCTAGTCGCTTCATGGCTCATCTATCATATTCCAGT
ATCCGTCTGAGCGAAGCTGGAAATCGGCCAACGGTCGTTAAGAAAGACTCAAAGCAGGTGCAATGCGGAGAGGATATAGCTAACGACATGGTGCTGAGGG
TGGCTGATCCGACCCAGGAAGGATGGGGGGAAGCTGGATCGAAACCCAATGATGCAGTGATCCTTAGACTGGAGTGACACAGAGGTCAGTAGGACCGGAG
CAGTGTTCACCCATCCAGTCAGTGTTCACCCACGTTGGCATGAGCGAACTTCGAGCACGTAGAGGCTGCATCCAGTCAGGCTACGGCCACCCCATCAAAC
CGAATAAATAAGAAAAATCTGCCCCTCAAGTCGCACCCTTGTGGCCATATCGCTCGTTCCAGTGTTGCGAGTTGAGGGGCGGTGGGTACACTCGACCCCC
CCCATCCCGCCTTCCTTCGCCGACCTGGCCAGACGGAAAGAAAGCCGCCGGGTCAAACAGCAAAGTGCCGCGGACAGTGCGGGGCGGCGGGGCCACTTGC
GAGAGTTCGGCGGTCGCGCACGAGGCGCACGAAGCGAGCGA