Description :
Non Conding Region
Location :
Scaffold_1:77829- 78228
Sequence
399 bases(100 bases per row)
CCAATACACACATATAGCAAAGTGTGCAAATACAGACATACACCAGCACAATGATGCATATACACTCATCACCTCCATATAGACGCCATAAATTATTATC
CAAGTTACATGCACGCATCCATTGCAAGTTTCAGTGCACCCTCGCCACCCACCTTGTCCTCAGGAATCAACTATCATATACGTAGAGATTCTCTCTTTGT
AAGACATTTTATAGTCGAATAGCGGGCTCCATAGGAGCGAGTTCGTGGGGGTCAAAAGCTACATTTGCACGATTTTTCTCCGCCTCCGAGATCTCGAAAA
GCTTGTCCACGAAAAAAGACGTCGCCACGCACCGTTTAGCCGGATCGTGTTTTGCCATCAGCTCGATCAGGTTCCACTGCTTATCAGTGATCCGCCGTC